Incidental Mutation 'R5606:Olfr1356'
ID439301
Institutional Source Beutler Lab
Gene Symbol Olfr1356
Ensembl Gene ENSMUSG00000051190
Gene Nameolfactory receptor 1356
SynonymsMOR142-1, MOR142-2_p, GA_x6K02T2QGN0-2962025-2962987
MMRRC Submission 043157-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.246) question?
Stock #R5606 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location78845052-78852166 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78847561 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 118 (M118T)
Ref Sequence ENSEMBL: ENSMUSP00000144815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061289] [ENSMUST00000205100]
Predicted Effect probably benign
Transcript: ENSMUST00000061289
AA Change: M118T

PolyPhen 2 Score 0.193 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000054345
Gene: ENSMUSG00000051190
AA Change: M118T

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.6e-58 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.4e-5 PFAM
Pfam:7tm_1 41 290 6.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205100
AA Change: M118T

PolyPhen 2 Score 0.193 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000144815
Gene: ENSMUSG00000051190
AA Change: M118T

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.6e-58 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.4e-5 PFAM
Pfam:7tm_1 41 290 6.5e-22 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1a7 A G 19: 20,722,367 S75P probably damaging Het
Ankib1 A T 5: 3,701,907 I711N probably damaging Het
Ankmy2 A G 12: 36,165,921 N40S probably benign Het
Armc8 T C 9: 99,536,262 K80E probably benign Het
BC005561 T C 5: 104,521,878 I1422T probably benign Het
Blm C A 7: 80,460,832 probably null Het
Cand1 C A 10: 119,211,454 Q710H possibly damaging Het
Ckap2l A T 2: 129,286,039 I73N probably damaging Het
Ddx27 T A 2: 167,019,966 D129E probably benign Het
Dnm3 T C 1: 162,286,018 E491G probably damaging Het
Fgd6 C A 10: 94,138,328 Y1310* probably null Het
Gm7534 A C 4: 134,200,212 V410G probably benign Het
Hnrnph3 C T 10: 63,019,443 R21H possibly damaging Het
Hs3st4 C A 7: 124,397,142 Q344K probably damaging Het
Hyal3 T C 9: 107,585,066 S100P probably benign Het
Map3k19 G A 1: 127,822,957 R886C probably benign Het
Mmrn2 G A 14: 34,397,624 D187N probably damaging Het
Myo5c G A 9: 75,275,508 A810T probably damaging Het
Noxa1 T A 2: 25,086,280 E332V possibly damaging Het
Olfr129 T C 17: 38,054,802 T264A probably damaging Het
Olfr536 T A 7: 140,503,800 I220F probably damaging Het
Olfr550 T C 7: 102,579,274 S260P probably damaging Het
Parg T A 14: 32,262,736 V241E probably damaging Het
Pitrm1 T A 13: 6,560,065 V391D probably damaging Het
Plch1 A T 3: 63,740,687 V421E probably benign Het
Slc27a2 C T 2: 126,564,690 A98V probably damaging Het
Spta1 A T 1: 174,219,902 H1704L probably damaging Het
Tbpl2 G A 2: 24,087,233 P258S possibly damaging Het
Tlr11 T C 14: 50,362,260 C568R probably benign Het
Tmem260 T A 14: 48,484,980 M324K probably damaging Het
Tmprss11g T A 5: 86,487,410 T402S probably damaging Het
Trim21 C G 7: 102,559,606 R302P probably damaging Het
Uox T A 3: 146,610,302 Y21* probably null Het
Vmn1r74 A G 7: 11,846,895 M41V probably benign Het
Vmn2r59 A C 7: 42,045,894 S365A probably benign Het
Zfp345 A T 2: 150,474,868 Y6* probably null Het
Other mutations in Olfr1356
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Olfr1356 APN 10 78847763 missense probably damaging 1.00
IGL01343:Olfr1356 APN 10 78847597 missense probably damaging 0.97
IGL01576:Olfr1356 APN 10 78847373 missense possibly damaging 0.94
IGL02314:Olfr1356 APN 10 78847265 missense probably damaging 1.00
IGL02474:Olfr1356 APN 10 78847063 missense probably damaging 1.00
IGL02960:Olfr1356 APN 10 78847537 missense probably damaging 1.00
IGL03049:Olfr1356 APN 10 78847522 missense possibly damaging 0.81
IGL03328:Olfr1356 APN 10 78847367 missense probably benign 0.39
R1602:Olfr1356 UTSW 10 78846968 missense probably benign
R1722:Olfr1356 UTSW 10 78846971 missense probably benign
R2178:Olfr1356 UTSW 10 78847778 missense probably damaging 0.96
R3903:Olfr1356 UTSW 10 78847298 missense probably benign 0.00
R3904:Olfr1356 UTSW 10 78847298 missense probably benign 0.00
R4241:Olfr1356 UTSW 10 78847905 missense probably benign 0.00
R4833:Olfr1356 UTSW 10 78847575 missense probably damaging 1.00
R5465:Olfr1356 UTSW 10 78847018 missense probably benign 0.00
R5527:Olfr1356 UTSW 10 78847775 missense probably benign 0.02
R5977:Olfr1356 UTSW 10 78847738 missense possibly damaging 0.95
R6219:Olfr1356 UTSW 10 78847259 missense possibly damaging 0.88
R6996:Olfr1356 UTSW 10 78847517 missense probably benign 0.00
R7136:Olfr1356 UTSW 10 78847781 missense probably benign 0.43
R7782:Olfr1356 UTSW 10 78847613 missense probably benign 0.01
R7996:Olfr1356 UTSW 10 78847321 missense probably damaging 1.00
Z1176:Olfr1356 UTSW 10 78847021 missense possibly damaging 0.73
Z1177:Olfr1356 UTSW 10 78847456 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGACTTCGGGAAGATCACAG -3'
(R):5'- TGTGGCCATCATATCTGACCC -3'

Sequencing Primer
(F):5'- GATCACAGAAAAAGTGTGGAATTTCC -3'
(R):5'- ACCTGCACATGCCCATG -3'
Posted On2016-10-26