Incidental Mutation 'R4842:Zfp865'
ID439442
Institutional Source Beutler Lab
Gene Symbol Zfp865
Ensembl Gene ENSMUSG00000116184
Gene Name
Synonyms
MMRRC Submission 042455-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R4842 (G1)
Quality Score51
Status Validated
Chromosome7
Chromosomal Location5034118-5035246 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5031641 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 875 (Y875C)
Ref Sequence ENSEMBL: ENSMUSP00000075601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062428] [ENSMUST00000076251] [ENSMUST00000076791] [ENSMUST00000085427] [ENSMUST00000207050] [ENSMUST00000208728]
Predicted Effect probably benign
Transcript: ENSMUST00000062428
SMART Domains Protein: ENSMUSP00000051979
Gene: ENSMUSG00000043290

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
ZnF_C2H2 64 86 1.02e1 SMART
ZnF_C2H2 100 122 9.96e-1 SMART
ZnF_C2H2 128 150 6.67e-2 SMART
low complexity region 180 192 N/A INTRINSIC
ZnF_C2H2 195 217 4.11e-2 SMART
ZnF_C2H2 223 245 7.26e-3 SMART
ZnF_C2H2 251 273 3.21e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000076251
AA Change: Y875C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075601
Gene: ENSMUSG00000074405
AA Change: Y875C

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
low complexity region 62 82 N/A INTRINSIC
low complexity region 120 141 N/A INTRINSIC
low complexity region 171 193 N/A INTRINSIC
ZnF_C2H2 220 242 1.28e-3 SMART
ZnF_C2H2 248 270 5.5e-3 SMART
low complexity region 274 286 N/A INTRINSIC
low complexity region 294 324 N/A INTRINSIC
ZnF_C2H2 350 372 8.81e-2 SMART
ZnF_C2H2 378 400 6.08e-5 SMART
ZnF_C2H2 407 429 1.79e-2 SMART
ZnF_C2H2 439 461 1.92e-2 SMART
low complexity region 478 495 N/A INTRINSIC
low complexity region 502 516 N/A INTRINSIC
low complexity region 523 542 N/A INTRINSIC
ZnF_C2H2 546 568 4.47e-3 SMART
ZnF_C2H2 574 596 5.42e-2 SMART
ZnF_C2H2 602 624 1.72e-4 SMART
low complexity region 628 660 N/A INTRINSIC
ZnF_C2H2 664 686 5.34e-1 SMART
ZnF_C2H2 692 714 2.82e0 SMART
low complexity region 725 745 N/A INTRINSIC
low complexity region 750 770 N/A INTRINSIC
low complexity region 772 788 N/A INTRINSIC
ZnF_C2H2 791 813 1.64e-1 SMART
ZnF_C2H2 819 841 9.3e-1 SMART
ZnF_C2H2 847 869 2.95e-3 SMART
ZnF_C2H2 875 897 3.83e-2 SMART
ZnF_C2H2 903 925 2.05e-2 SMART
ZnF_C2H2 931 953 1.18e-2 SMART
ZnF_C2H2 959 981 1.36e-2 SMART
ZnF_C2H2 988 1010 5.06e-2 SMART
ZnF_C2H2 1016 1038 4.72e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000076791
Predicted Effect probably benign
Transcript: ENSMUST00000085427
SMART Domains Protein: ENSMUSP00000082550
Gene: ENSMUSG00000074405

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
low complexity region 62 82 N/A INTRINSIC
low complexity region 120 141 N/A INTRINSIC
low complexity region 171 193 N/A INTRINSIC
ZnF_C2H2 220 242 1.28e-3 SMART
ZnF_C2H2 248 270 5.5e-3 SMART
low complexity region 274 286 N/A INTRINSIC
low complexity region 294 324 N/A INTRINSIC
ZnF_C2H2 350 372 8.81e-2 SMART
ZnF_C2H2 378 400 6.08e-5 SMART
ZnF_C2H2 407 429 1.79e-2 SMART
ZnF_C2H2 439 461 1.92e-2 SMART
low complexity region 478 495 N/A INTRINSIC
low complexity region 502 516 N/A INTRINSIC
low complexity region 523 542 N/A INTRINSIC
ZnF_C2H2 546 568 4.47e-3 SMART
ZnF_C2H2 574 596 5.42e-2 SMART
ZnF_C2H2 602 624 1.72e-4 SMART
low complexity region 628 660 N/A INTRINSIC
ZnF_C2H2 664 686 5.34e-1 SMART
ZnF_C2H2 692 714 2.82e0 SMART
low complexity region 725 745 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207362
Predicted Effect probably benign
Transcript: ENSMUST00000208728
Meta Mutation Damage Score 0.3335 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 95% (107/113)
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik A T 17: 14,943,739 I43L possibly damaging Het
4930449A18Rik T A 3: 59,841,732 noncoding transcript Het
9530053A07Rik T A 7: 28,150,722 C1198S probably damaging Het
Abcc8 T C 7: 46,150,828 K510R probably damaging Het
Adamtsl3 C T 7: 82,528,861 R511C probably damaging Het
Arhgap11a T C 2: 113,839,762 S339G probably damaging Het
C2cd3 A G 7: 100,416,190 T728A probably benign Het
Cand1 C A 10: 119,213,546 probably null Het
Catspere1 A T 1: 177,872,058 noncoding transcript Het
Cd209c G T 8: 3,945,905 R2S probably benign Het
Cdc16 A G 8: 13,781,644 probably benign Het
Ces1g C T 8: 93,333,695 E99K probably benign Het
Chrna7 A C 7: 63,212,448 L10R probably benign Het
Clnk C T 5: 38,713,069 probably null Het
Cntrob C G 11: 69,315,394 L315F possibly damaging Het
Ctdp1 A G 18: 80,408,726 S145P unknown Het
Dennd2a T C 6: 39,497,110 D430G probably damaging Het
Dnajc16 A G 4: 141,774,625 F298S probably damaging Het
Dock5 T C 14: 67,817,563 D618G probably damaging Het
Drc3 G A 11: 60,370,535 A171T probably benign Het
Ecel1 A T 1: 87,153,301 N322K probably damaging Het
Eftud2 A G 11: 102,854,814 F362L probably damaging Het
Egfr C T 11: 16,911,607 H1129Y probably benign Het
Eif2b1 A G 5: 124,576,908 S102P probably damaging Het
Erich3 T A 3: 154,704,843 F112I possibly damaging Het
Fam107b T C 2: 3,778,543 L261S probably damaging Het
Fam198b G A 3: 79,936,605 R377H probably damaging Het
Fat3 A C 9: 15,997,587 V2373G probably damaging Het
Gadd45a A T 6: 67,036,889 L58Q probably damaging Het
Gipr C T 7: 19,162,676 R165H probably damaging Het
Gje1 C T 10: 14,717,338 G45R probably null Het
Gldc T A 19: 30,133,732 N548I possibly damaging Het
Gm13035 A G 4: 146,073,423 noncoding transcript Het
Gm27013 T A 6: 130,520,737 noncoding transcript Het
Gm5436 A T 12: 84,258,810 noncoding transcript Het
Gm6588 A T 5: 112,450,240 K218* probably null Het
Grik3 C A 4: 125,691,176 N612K probably damaging Het
Hfm1 C A 5: 106,892,751 W716L probably damaging Het
Hist1h2bl C T 13: 21,716,064 probably benign Het
Il5ra T C 6: 106,738,375 Y166C probably damaging Het
Iqcb1 A G 16: 36,835,590 E113G probably benign Het
Kcnk10 A T 12: 98,434,916 M486K probably benign Het
Kcnv2 A G 19: 27,323,790 D347G probably damaging Het
Kif21b C A 1: 136,145,220 H119N probably damaging Het
Lamb1 C T 12: 31,287,433 H388Y probably damaging Het
Leng9 T C 7: 4,149,386 D97G probably damaging Het
Lmbr1 G A 5: 29,287,426 T55I probably damaging Het
Lrp1 G T 10: 127,583,936 R935S probably damaging Het
Lrp2 A T 2: 69,469,411 V3099E probably benign Het
Lrrcc1 C A 3: 14,562,511 D503E probably benign Het
Map1a T A 2: 121,302,086 S890T probably damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Mybph A T 1: 134,198,495 E349V probably damaging Het
Myh7b C A 2: 155,633,989 L1935M probably benign Het
Myh9 T C 15: 77,769,253 E1348G probably damaging Het
Myzap A G 9: 71,548,755 S328P probably damaging Het
Nbeal1 T C 1: 60,253,375 L1062P probably damaging Het
Nepro G A 16: 44,734,797 S412N probably null Het
Nr1h3 A G 2: 91,190,218 F257L probably benign Het
Nudt5 T C 2: 5,864,428 V155A probably benign Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr522 A G 7: 140,162,689 L87P possibly damaging Het
Olfr539 A T 7: 140,667,589 I94F probably damaging Het
Olfr653 A T 7: 104,580,215 I190L probably benign Het
Pde1a T A 2: 80,128,837 probably benign Het
Pde4dip T A 3: 97,793,528 H220L probably damaging Het
Pde9a T A 17: 31,443,161 probably null Het
Pnkp C A 7: 44,861,646 probably null Het
Pnpla7 A G 2: 24,980,052 T15A probably benign Het
Polq G T 16: 37,048,783 probably null Het
Ppfia2 C T 10: 106,854,957 T553I probably benign Het
Ptk6 T G 2: 181,196,991 N323T possibly damaging Het
Rhox3c G A X: 37,470,424 A60T probably damaging Het
Rnf4 T A 5: 34,348,709 V61E probably damaging Het
Rnf5 A G 17: 34,602,003 probably benign Het
Sardh A G 2: 27,191,955 V853A probably benign Het
Scfd1 T C 12: 51,389,326 V86A probably damaging Het
Scube3 G A 17: 28,164,123 C425Y probably damaging Het
Sema5a C T 15: 32,609,417 H490Y probably benign Het
Sfta2 T C 17: 35,649,881 probably benign Het
Sh3d19 T C 3: 86,123,742 Y738H probably damaging Het
Shc2 T C 10: 79,622,461 R463G probably damaging Het
Socs7 T A 11: 97,377,003 I320N possibly damaging Het
Speer2 A T 16: 69,858,100 M159K probably benign Het
Sppl2c A C 11: 104,187,652 H426P probably benign Het
Stag3 T G 5: 138,309,365 probably null Het
Stxbp5 C A 10: 9,762,891 V1055L probably benign Het
Synpo A T 18: 60,603,612 S421T probably damaging Het
Taf6l A G 19: 8,782,406 V135A possibly damaging Het
Tas2r116 G A 6: 132,855,697 S87N probably benign Het
Tomm6 T C 17: 47,688,069 probably benign Het
Trabd T C 15: 89,082,712 M113T probably benign Het
Trim58 G A 11: 58,651,324 G370E probably damaging Het
Ttc41 C T 10: 86,731,125 R552C probably benign Het
Vit T C 17: 78,601,879 S252P probably benign Het
Vma21-ps T A 4: 52,496,943 D101V probably damaging Het
Vmn1r173 A T 7: 23,702,936 I199F probably damaging Het
Vmn2r114 T A 17: 23,310,362 R255S probably benign Het
Vmn2r17 A G 5: 109,434,380 N545S probably damaging Het
Other mutations in Zfp865
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01731:Zfp865 APN 7 5029876 missense probably benign
IGL02041:Zfp865 APN 7 5031373 missense probably benign
IGL03118:Zfp865 APN 7 5034645 intron probably benign
R0613:Zfp865 UTSW 7 5029091 missense possibly damaging 0.86
R0879:Zfp865 UTSW 7 5031343 missense probably benign
R0938:Zfp865 UTSW 7 5031404 missense possibly damaging 0.96
R1448:Zfp865 UTSW 7 5029279 nonsense probably null
R3955:Zfp865 UTSW 7 5032014 missense probably damaging 0.96
R4841:Zfp865 UTSW 7 5031641 missense probably damaging 1.00
R5044:Zfp865 UTSW 7 5034669 intron probably benign
R5773:Zfp865 UTSW 7 5034694 intron probably benign
R5843:Zfp865 UTSW 7 5030417 missense probably benign 0.03
R5849:Zfp865 UTSW 7 5031087 missense probably damaging 1.00
R6393:Zfp865 UTSW 7 5030066 missense probably damaging 1.00
R6480:Zfp865 UTSW 7 5029783 missense probably damaging 0.98
R6681:Zfp865 UTSW 7 5029451 missense possibly damaging 0.86
R6880:Zfp865 UTSW 7 5030549 missense probably damaging 1.00
R7252:Zfp865 UTSW 7 5034417 intron probably benign
R7302:Zfp865 UTSW 7 5029253 missense possibly damaging 0.96
R7486:Zfp865 UTSW 7 5031260 missense possibly damaging 0.85
R7611:Zfp865 UTSW 7 5031131 missense probably damaging 0.99
R8058:Zfp865 UTSW 7 5030446 missense probably benign
R8327:Zfp865 UTSW 7 5031059 missense probably benign 0.08
R8728:Zfp865 UTSW 7 5031820 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGACTCATAAGTATGTGCACCTGG -3'
(R):5'- CAGGTAGAAGAAGCCCTTGC -3'

Sequencing Primer
(F):5'- GCAGAAACGGGGTTTCC -3'
(R):5'- TAGAAGAAGCCCTTGCCGCAG -3'
Posted On2016-10-28