Incidental Mutation 'R5636:Islr2'
ID 440375
Institutional Source Beutler Lab
Gene Symbol Islr2
Ensembl Gene ENSMUSG00000051243
Gene Name immunoglobulin superfamily containing leucine-rich repeat 2
Synonyms Linx, mbu-3, B930052A04Rik
MMRRC Submission 043287-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5636 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 58196297-58204319 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 58201301 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 35 (T35A)
Ref Sequence ENSEMBL: ENSMUSP00000130879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114144] [ENSMUST00000163200] [ENSMUST00000163897] [ENSMUST00000165276] [ENSMUST00000170421] [ENSMUST00000214647] [ENSMUST00000214649] [ENSMUST00000215950] [ENSMUST00000216231] [ENSMUST00000217578] [ENSMUST00000217050] [ENSMUST00000216297] [ENSMUST00000217427] [ENSMUST00000217512]
AlphaFold Q5RKR3
Predicted Effect probably benign
Transcript: ENSMUST00000114144
SMART Domains Protein: ENSMUSP00000109781
Gene: ENSMUSG00000051243

DomainStartEndE-ValueType
LRRNT 19 55 1.1e-1 SMART
LRR 49 73 8.24e0 SMART
LRR 98 121 1.91e1 SMART
LRR 122 145 3.07e-1 SMART
LRR_TYP 146 169 1.58e-3 SMART
LRRCT 181 231 2.36e-12 SMART
IG 245 374 2.99e-2 SMART
low complexity region 510 535 N/A INTRINSIC
transmembrane domain 591 613 N/A INTRINSIC
low complexity region 662 682 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163200
AA Change: T35A

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000130879
Gene: ENSMUSG00000051243
AA Change: T35A

DomainStartEndE-ValueType
LRRNT 63 99 1.1e-1 SMART
LRR 93 117 8.24e0 SMART
LRR 142 165 1.91e1 SMART
LRR 166 189 3.07e-1 SMART
LRR_TYP 190 213 1.58e-3 SMART
LRRCT 225 275 2.36e-12 SMART
IG 289 418 2.99e-2 SMART
low complexity region 554 579 N/A INTRINSIC
transmembrane domain 635 657 N/A INTRINSIC
low complexity region 706 726 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163897
SMART Domains Protein: ENSMUSP00000130322
Gene: ENSMUSG00000051243

DomainStartEndE-ValueType
LRRNT 19 55 1.1e-1 SMART
LRR 49 73 8.24e0 SMART
LRR 98 121 1.91e1 SMART
LRR 122 145 3.07e-1 SMART
LRR_TYP 146 169 1.58e-3 SMART
LRRCT 181 231 2.36e-12 SMART
IG 245 374 2.99e-2 SMART
low complexity region 510 535 N/A INTRINSIC
transmembrane domain 591 613 N/A INTRINSIC
low complexity region 662 682 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165276
SMART Domains Protein: ENSMUSP00000129328
Gene: ENSMUSG00000051243

DomainStartEndE-ValueType
LRRNT 19 55 1.1e-1 SMART
LRR 49 73 8.24e0 SMART
LRR 98 121 1.91e1 SMART
LRR 122 145 3.07e-1 SMART
LRR_TYP 146 169 1.58e-3 SMART
LRRCT 181 231 2.36e-12 SMART
IG 245 374 2.99e-2 SMART
low complexity region 510 535 N/A INTRINSIC
transmembrane domain 591 613 N/A INTRINSIC
low complexity region 662 682 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170421
SMART Domains Protein: ENSMUSP00000127228
Gene: ENSMUSG00000051243

DomainStartEndE-ValueType
LRRNT 19 55 1.1e-1 SMART
LRR 49 73 8.24e0 SMART
LRR 98 121 1.91e1 SMART
LRR 122 145 3.07e-1 SMART
LRR_TYP 146 169 1.58e-3 SMART
LRRCT 181 231 2.36e-12 SMART
IG 245 374 2.99e-2 SMART
low complexity region 510 535 N/A INTRINSIC
transmembrane domain 591 613 N/A INTRINSIC
low complexity region 662 682 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179787
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213495
Predicted Effect probably benign
Transcript: ENSMUST00000214647
Predicted Effect probably benign
Transcript: ENSMUST00000214649
Predicted Effect probably benign
Transcript: ENSMUST00000215950
Predicted Effect probably benign
Transcript: ENSMUST00000216231
Predicted Effect probably benign
Transcript: ENSMUST00000217578
Predicted Effect probably benign
Transcript: ENSMUST00000217050
Predicted Effect probably benign
Transcript: ENSMUST00000216297
Predicted Effect probably benign
Transcript: ENSMUST00000217427
Predicted Effect probably benign
Transcript: ENSMUST00000217512
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216359
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217158
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit perinatal lethality, absent tail pinch response, and defective peroneal and tibial nerve morphology and branch extension. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf C T 19: 31,944,982 Q448* probably null Het
Abca5 A G 11: 110,301,536 Y717H probably benign Het
Abcg2 T A 6: 58,672,056 D295E probably damaging Het
Accsl C T 2: 93,869,025 E7K probably benign Het
Acvr2b A G 9: 119,428,309 Y152C probably damaging Het
Akap13 A G 7: 75,704,372 E1747G probably damaging Het
Arpp19 C T 9: 75,037,933 probably benign Het
Atp10d A G 5: 72,288,219 Y74C probably damaging Het
Atp6v0b T C 4: 117,886,385 probably benign Het
Bms1 C A 6: 118,388,825 M1133I probably benign Het
Bysl A C 17: 47,602,723 D259E probably benign Het
Capn1 A T 19: 6,014,442 V9E probably benign Het
Cdkl2 T C 5: 92,033,742 I127V probably benign Het
Cyp2c38 G A 19: 39,438,306 Q184* probably null Het
Cypt12 C T 3: 17,948,585 R41C probably benign Het
Fat2 T C 11: 55,282,481 I2469V probably damaging Het
Fbxo38 A G 18: 62,511,018 V923A possibly damaging Het
Gm13889 A G 2: 93,956,686 C148R probably damaging Het
Gpd1 A T 15: 99,722,058 T223S probably benign Het
Hcrtr1 C A 4: 130,130,945 G383C possibly damaging Het
Hivep1 C T 13: 42,163,456 P2047S possibly damaging Het
Lgr6 T C 1: 134,987,078 D644G probably benign Het
Lrrc6 A T 15: 66,500,816 probably null Het
Mdn1 C T 4: 32,695,480 T1173I probably damaging Het
Mon1a T C 9: 107,901,240 V221A probably damaging Het
Mrgprb4 A G 7: 48,198,470 C237R probably benign Het
Myo1b A G 1: 51,797,528 M264T probably damaging Het
Naxd A G 8: 11,502,676 N32S probably benign Het
Nlrp12 A T 7: 3,225,294 L1010Q probably damaging Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Nuggc A T 14: 65,648,188 K755* probably null Het
Olfr1501 C T 19: 13,838,337 V279M possibly damaging Het
Olfr332 T C 11: 58,490,051 K235E probably damaging Het
Pik3ca G A 3: 32,461,560 R794Q probably damaging Het
Pnp2 A G 14: 50,956,192 probably null Het
Ric3 G A 7: 109,038,820 T242I probably damaging Het
Rnf213 G A 11: 119,436,629 R1814K probably benign Het
Rnf213 A C 11: 119,436,905 Q1906P probably damaging Het
Rufy2 T A 10: 62,997,954 I265N probably damaging Het
Scap G T 9: 110,380,594 G744C probably damaging Het
Serpinb3c T C 1: 107,275,014 Q88R possibly damaging Het
Sf3b1 T C 1: 54,997,193 D907G probably damaging Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc4a3 C T 1: 75,554,216 L749F possibly damaging Het
Smtn T G 11: 3,517,829 probably null Het
Spag9 C A 11: 94,069,012 D342E probably damaging Het
Sptbn5 G A 2: 120,057,404 probably benign Het
Stam G T 2: 14,117,427 M112I probably damaging Het
Tex35 C T 1: 157,100,224 W125* probably null Het
Tmem215 A G 4: 40,474,394 E157G probably damaging Het
Traf6 G A 2: 101,696,909 V335M probably benign Het
Ubr5 T A 15: 37,983,996 K2302N probably damaging Het
Vmn2r78 A G 7: 86,954,429 H605R probably damaging Het
Other mutations in Islr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Islr2 APN 9 58199786 missense probably benign 0.03
IGL01444:Islr2 APN 9 58198378 missense probably damaging 1.00
R0346:Islr2 UTSW 9 58198343 nonsense probably null
R0360:Islr2 UTSW 9 58199744 missense possibly damaging 0.82
R0364:Islr2 UTSW 9 58199744 missense possibly damaging 0.82
R0528:Islr2 UTSW 9 58199362 missense probably damaging 0.97
R0693:Islr2 UTSW 9 58199744 missense possibly damaging 0.82
R1854:Islr2 UTSW 9 58199816 missense probably damaging 0.97
R2893:Islr2 UTSW 9 58197866 missense probably damaging 1.00
R3747:Islr2 UTSW 9 58199642 missense probably benign 0.00
R3914:Islr2 UTSW 9 58198383 nonsense probably null
R4176:Islr2 UTSW 9 58199900 missense probably damaging 1.00
R4212:Islr2 UTSW 9 58199320 missense probably damaging 1.00
R4844:Islr2 UTSW 9 58208234 unclassified probably benign
R5303:Islr2 UTSW 9 58208275 unclassified probably benign
R5787:Islr2 UTSW 9 58198354 missense probably damaging 0.97
R5883:Islr2 UTSW 9 58198715 missense probably benign 0.01
R6406:Islr2 UTSW 9 58199980 missense probably benign
R7105:Islr2 UTSW 9 58197814 missense probably damaging 1.00
R7130:Islr2 UTSW 9 58198292 missense probably damaging 1.00
R7316:Islr2 UTSW 9 58197967 missense probably damaging 0.99
X0026:Islr2 UTSW 9 58198286 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACTTGAGGGTCCTGTCAG -3'
(R):5'- AAACCTGCAATCCTGGAGAAG -3'

Sequencing Primer
(F):5'- TTGGAAGACCCTCTCCTACAC -3'
(R):5'- CCTGCAATCCTGGAGAAGTAGGG -3'
Posted On 2016-11-08