Mutagenetix > Incidental Mutations

Incidental Mutation 'R5639:Gpc5'

440564

Institutional Source

Beutler Lab

Gene Symbol

Gpc5

Ensembl Gene

ENSMUSG00000022112

Gene Name

glypican 5

Synonyms

A230034F01Rik

MMRRC Submission

043288-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5639 (G1)

Quality Score

217

Status

Not validated

Chromosome

Chromosomal Location

115092215-116525179 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 115092747 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 114 (L114P)

Ref Sequence

ENSEMBL: ENSMUSP00000135857 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022707] [ENSMUST00000175665] [ENSMUST00000176912]

Predicted Effect

probably benign
Transcript: ENSMUST00000022707
AA Change: L41P

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000022707
Gene: ENSMUSG00000022112
AA Change: L41P

Domain	Start	End	E-Value	Type
Pfam:Glypican	9	572	1.8e-182	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000175665
AA Change: L114P

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000135857
Gene: ENSMUSG00000022112
AA Change: L114P

Domain	Start	End	E-Value	Type
Pfam:Glypican	82	480	1.3e-142	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000176912
AA Change: L114P

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000135085
Gene: ENSMUSG00000022112
AA Change: L114P

Domain	Start	End	E-Value	Type
Pfam:Glypican	85	642	1.6e-174	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176993

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.5%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cell surface heparan sulfate proteoglycans are composed of a membrane-associated protein core substituted with a variable number of heparan sulfate chains. Members of the glypican-related integral membrane proteoglycan family (GRIPS) contain a core protein anchored to the cytoplasmic membrane via a glycosyl phosphatidylinositol linkage. These proteins may play a role in the control of cell division and growth regulation. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aars	T	C	8: 111,043,234	Y322H	probably benign	Het
Aldh1a1	C	A	19: 20,623,422	T201K	probably damaging	Het
Ankrd26	T	C	6: 118,539,724	E493G	possibly damaging	Het
Armc8	A	G	9: 99,496,149		probably null	Het
Bicc1	A	T	10: 70,940,520	V701E	probably damaging	Het
Car11	T	A	7: 45,702,621		probably null	Het
Celsr1	C	G	15: 86,030,767	V1002L	probably damaging	Het
Clpx	T	A	9: 65,329,830	S597T	probably benign	Het
Cyr61	A	C	3: 145,648,697	V153G	probably damaging	Het
Dmpk	A	G	7: 19,092,600	M545V	probably benign	Het
Dnah7c	C	G	1: 46,739,668	D3139E	probably benign	Het
Drd5	T	A	5: 38,319,835	V57D	possibly damaging	Het
Epc2	A	G	2: 49,451,891	N29S	possibly damaging	Het
Ercc3	T	C	18: 32,265,714	V682A	probably damaging	Het
Fam186a	T	C	15: 99,947,050	K438E	unknown	Het
Farp1	T	A	14: 121,275,382	I764N	probably damaging	Het
Flvcr2	A	T	12: 85,747,476	I209F	probably benign	Het
Fndc3b	C	T	3: 27,426,153	V1065M	probably damaging	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
Gp6	C	A	7: 4,394,131	D102Y	probably damaging	Het
Kcnq3	T	A	15: 65,997,750	E613V	probably damaging	Het
Krt74	T	G	15: 101,756,760		noncoding transcript	Het
Lipe	T	C	7: 25,383,325	T801A	probably benign	Het
Lman1l	A	T	9: 57,611,866	F266I	probably benign	Het
Lrp1	A	G	10: 127,593,839	V454A	probably damaging	Het
Lsm14a	T	C	7: 34,353,510	D338G	probably damaging	Het
Mctp1	T	C	13: 77,024,783		silent	Het
Mgea5	A	G	19: 45,776,999	I123T	probably damaging	Het
Nlrp4a	G	A	7: 26,457,030	A727T	probably benign	Het
Nrgn	T	C	9: 37,546,048	S48G	probably benign	Het
Olfr1246	T	C	2: 89,590,725	Y130C	probably damaging	Het
Olfr370	T	C	8: 83,541,344	S67P	probably damaging	Het
Olfr564	A	G	7: 102,803,993	S172G	probably benign	Het
Pdia6	A	G	12: 17,278,593	E183G	probably benign	Het
Pign	T	A	1: 105,589,315	I529F	probably benign	Het
Plscr5	A	T	9: 92,205,511	K178*	probably null	Het
Samm50	T	G	15: 84,214,128	I456S	probably benign	Het
Sesn1	A	G	10: 41,811,271	R84G	probably benign	Het
Skint8	C	A	4: 111,950,193	L359M	probably damaging	Het
Spag17	G	T	3: 100,056,166	D1067Y	probably damaging	Het
Sptan1	C	T	2: 29,990,993	Q425*	probably null	Het
Srrm4	T	A	5: 116,591,359	I36F	unknown	Het
Tas1r2	A	T	4: 139,659,796	S189C	probably damaging	Het
Tep1	A	G	14: 50,853,605	V690A	possibly damaging	Het
Trmo	T	C	4: 46,382,073	K348R	probably benign	Het
Trmu	T	A	15: 85,882,698	M36K	probably damaging	Het
Ubr4	A	G	4: 139,452,648	T3380A	possibly damaging	Het
Unc79	A	C	12: 103,171,572	T2425P	probably damaging	Het
Vmn2r12	G	A	5: 109,092,800	T149I	probably benign	Het
Vwa3a	A	C	7: 120,790,143	K68T	probably damaging	Het
Yif1a	T	C	19: 5,088,750		probably null	Het
Zbtb44	A	T	9: 31,054,052	T253S	probably damaging	Het
Zdhhc3	T	C	9: 123,100,345	Y75C	probably damaging	Het
Zfp189	T	A	4: 49,530,153	F419I	probably benign	Het
Zfp663	T	C	2: 165,353,009	D430G	probably benign	Het
Zfp709	T	G	8: 71,889,991		probably null	Het

Other mutations in Gpc5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00419:Gpc5	APN	14	115370024	missense	probably damaging	1.00
IGL01298:Gpc5	APN	14	115399188	missense	probably benign	0.14
IGL01359:Gpc5	APN	14	115369750	missense	possibly damaging	0.74
IGL02354:Gpc5	APN	14	115133287	nonsense	probably null
IGL02361:Gpc5	APN	14	115133287	nonsense	probably null
IGL02982:Gpc5	APN	14	115369988	missense	probably damaging	1.00
IGL03120:Gpc5	APN	14	115370144	missense	possibly damaging	0.64
R0322:Gpc5	UTSW	14	115399151	missense	probably benign	0.05
R0396:Gpc5	UTSW	14	115428208	missense	possibly damaging	0.91
R0555:Gpc5	UTSW	14	115552328	missense	probably damaging	0.98
R0629:Gpc5	UTSW	14	115552239	missense	possibly damaging	0.94
R1536:Gpc5	UTSW	14	115399250	missense	probably benign	0.09
R1660:Gpc5	UTSW	14	115399279	missense	probably benign	0.12
R1676:Gpc5	UTSW	14	115370098	missense	probably damaging	1.00
R2328:Gpc5	UTSW	14	115788179	missense	probably damaging	0.99
R3522:Gpc5	UTSW	14	116524335	missense	probably benign	0.00
R3776:Gpc5	UTSW	14	115370060	missense	probably benign	0.05
R3885:Gpc5	UTSW	14	115370060	missense	probably benign	0.05
R3889:Gpc5	UTSW	14	115370060	missense	probably benign	0.05
R3893:Gpc5	UTSW	14	115370060	missense	probably benign	0.05
R4041:Gpc5	UTSW	14	115133216	missense	probably damaging	1.00
R4517:Gpc5	UTSW	14	115552239	missense	possibly damaging	0.94
R5068:Gpc5	UTSW	14	115417264	makesense	probably null
R5730:Gpc5	UTSW	14	115788314	missense	possibly damaging	0.73
R5944:Gpc5	UTSW	14	115369838	missense	probably benign	0.24
R6351:Gpc5	UTSW	14	115399200	missense	probably benign	0.01
R6557:Gpc5	UTSW	14	115092534	unclassified	probably benign
R6657:Gpc5	UTSW	14	115370198	missense	probably benign	0.01
R6714:Gpc5	UTSW	14	115552303	nonsense	probably null
R6751:Gpc5	UTSW	14	115369951	missense	probably benign	0.00
R7057:Gpc5	UTSW	14	115133242	missense	possibly damaging	0.64
R7142:Gpc5	UTSW	14	115417203	missense	probably benign	0.01
R7225:Gpc5	UTSW	14	115552298	missense	probably damaging	1.00
R7544:Gpc5	UTSW	14	115428173	missense	probably damaging	1.00
R7658:Gpc5	UTSW	14	115428208	missense	possibly damaging	0.91
R7695:Gpc5	UTSW	14	115092594	missense	unknown
R7785:Gpc5	UTSW	14	115417220	missense	probably benign	0.00
R8116:Gpc5	UTSW	14	115399225	missense	probably damaging	0.98
R8303:Gpc5	UTSW	14	115428255	missense	probably benign	0.01
RF001:Gpc5	UTSW	14	115417178	missense	probably benign	0.41
RF022:Gpc5	UTSW	14	115552276	missense	probably damaging	1.00
Z1176:Gpc5	UTSW	14	115369964	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCGAACCCTTGCCAGATTC -3'
(R):5'- GTGAGCACACCAAGCATTCC -3'

Sequencing Primer
(F):5'- TTGCCAGATTCCGCCACG -3'
(R):5'- ACCCCGGTTCACCTACTGG -3'

Posted On

2016-11-08