Incidental Mutation 'R5699:Tubgcp2'
ID446572
Institutional Source Beutler Lab
Gene Symbol Tubgcp2
Ensembl Gene ENSMUSG00000025474
Gene Nametubulin, gamma complex associated protein 2
Synonyms1700022B05Rik
MMRRC Submission 043327-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock #R5699 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location139995955-140036669 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 139998788 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 757 (M757K)
Ref Sequence ENSEMBL: ENSMUSP00000147329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026547] [ENSMUST00000210224] [ENSMUST00000211638]
Predicted Effect probably benign
Transcript: ENSMUST00000026547
AA Change: M757K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000026547
Gene: ENSMUSG00000025474
AA Change: M757K

DomainStartEndE-ValueType
low complexity region 109 121 N/A INTRINSIC
Pfam:Spc97_Spc98 220 738 8.6e-123 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209930
Predicted Effect probably benign
Transcript: ENSMUST00000210224
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211186
Predicted Effect possibly damaging
Transcript: ENSMUST00000211638
AA Change: M757K

PolyPhen 2 Score 0.526 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700128F08Rik A G 9: 8,225,319 noncoding transcript Het
4930486L24Rik A G 13: 60,853,596 F106L possibly damaging Het
Adam11 A T 11: 102,773,640 M385L probably benign Het
Adgre1 C T 17: 57,481,007 P925S probably benign Het
Adh7 G A 3: 138,226,326 A234T probably benign Het
Ano2 A G 6: 125,872,740 E475G probably damaging Het
BC055324 A T 1: 163,957,551 V753D probably benign Het
C2cd4c A G 10: 79,612,551 V254A probably benign Het
Car13 A G 3: 14,650,689 Y89C probably damaging Het
Cd38 A G 5: 43,900,386 K100R probably damaging Het
Cdh11 A G 8: 102,634,543 I721T probably damaging Het
Cdh2 G A 18: 16,646,522 Q161* probably null Het
Clk1 T C 1: 58,420,195 K135R probably damaging Het
Col5a1 G A 2: 27,997,599 G961R unknown Het
Cpt1b T A 15: 89,424,273 I151F probably benign Het
Cyp51 A G 5: 4,101,213 F139L probably damaging Het
Disp1 TTGA T 1: 183,088,555 probably null Het
Dnah8 T C 17: 30,810,324 I4089T probably benign Het
Dnali1 C T 4: 125,059,050 V227M possibly damaging Het
Eml4 T G 17: 83,410,085 S29A probably benign Het
Eps8l3 C A 3: 107,879,579 P24T probably benign Het
Fancc A T 13: 63,330,632 probably null Het
Grid2 G A 6: 63,908,991 A124T probably damaging Het
Ikbke C T 1: 131,276,467 probably null Het
Kyat1 G A 2: 30,186,650 A284V probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lmbrd2 G T 15: 9,175,182 L393F probably benign Het
Lrrc26 T A 2: 25,290,524 L179Q probably damaging Het
Mlx A G 11: 101,088,694 D113G possibly damaging Het
Myod1 A G 7: 46,376,983 K104R probably damaging Het
Nwd1 G A 8: 72,702,974 probably null Het
Olfr1474 A G 19: 13,470,972 M1V probably null Het
Olfr663 T G 7: 104,703,993 V142G probably damaging Het
Olfr788 A C 10: 129,472,877 N62H probably damaging Het
Pacsin3 A T 2: 91,262,781 Y206F probably damaging Het
Pcdhgb5 T A 18: 37,731,917 V255E probably damaging Het
Pdp1 T C 4: 11,960,907 D468G possibly damaging Het
Pgr C T 9: 8,900,599 probably benign Het
Prrt2 T A 7: 127,018,727 Y345F probably benign Het
Rbbp8nl T C 2: 180,278,668 T515A probably damaging Het
Rc3h1 G T 1: 160,930,253 R47L probably damaging Het
Rfpl4b T A 10: 38,821,285 I107F possibly damaging Het
Rsbn1 T C 3: 103,962,485 F754S probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scn3a T C 2: 65,507,264 T630A possibly damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slco1a5 C A 6: 142,248,816 C367F probably damaging Het
Slit1 A G 19: 41,625,520 probably null Het
Slit2 G A 5: 48,220,991 probably null Het
Snrnp40 G T 4: 130,365,165 G122V possibly damaging Het
Stk16 T A 1: 75,213,604 M111K probably damaging Het
Tbc1d2 T C 4: 46,616,298 I477V probably benign Het
Tll1 T A 8: 64,117,940 E199D probably damaging Het
Trhde A T 10: 114,588,502 D459E probably benign Het
Ttn T C 2: 76,711,537 R25375G possibly damaging Het
Ubap1l T A 9: 65,372,055 V212D possibly damaging Het
Ubqln5 A G 7: 104,129,425 V64A possibly damaging Het
Usp47 A G 7: 112,109,997 M1337V probably benign Het
Vmn1r201 T A 13: 22,475,239 Y208N probably damaging Het
Xkr8 C T 4: 132,728,057 R335H probably damaging Het
Zbtb49 A T 5: 38,216,526 C25S probably damaging Het
Zeb2 T A 2: 44,997,788 N404I probably damaging Het
Other mutations in Tubgcp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Tubgcp2 APN 7 140031022 missense possibly damaging 0.58
IGL00791:Tubgcp2 APN 7 140001498 missense probably damaging 0.97
IGL02643:Tubgcp2 APN 7 139996154 missense probably damaging 1.00
IGL02710:Tubgcp2 APN 7 140004984 splice site probably benign
IGL03352:Tubgcp2 APN 7 140001027 missense probably benign 0.01
R0189:Tubgcp2 UTSW 7 140001605 splice site probably benign
R0333:Tubgcp2 UTSW 7 139999347 missense probably damaging 1.00
R0379:Tubgcp2 UTSW 7 140032192 missense probably damaging 1.00
R1051:Tubgcp2 UTSW 7 139998896 missense probably benign 0.26
R1192:Tubgcp2 UTSW 7 140029838 missense probably benign
R1528:Tubgcp2 UTSW 7 140033783 unclassified probably benign
R1728:Tubgcp2 UTSW 7 139998055 missense probably benign
R1729:Tubgcp2 UTSW 7 139998055 missense probably benign
R1784:Tubgcp2 UTSW 7 139998055 missense probably benign
R1888:Tubgcp2 UTSW 7 139999270 missense probably damaging 1.00
R1888:Tubgcp2 UTSW 7 140006156 missense probably damaging 1.00
R1888:Tubgcp2 UTSW 7 139999270 missense probably damaging 1.00
R1888:Tubgcp2 UTSW 7 140006156 missense probably damaging 1.00
R1967:Tubgcp2 UTSW 7 140006153 missense probably benign 0.09
R4514:Tubgcp2 UTSW 7 139996071 missense possibly damaging 0.51
R4545:Tubgcp2 UTSW 7 139996071 missense possibly damaging 0.51
R4774:Tubgcp2 UTSW 7 139996161 missense probably damaging 1.00
R4790:Tubgcp2 UTSW 7 139999288 missense probably damaging 1.00
R5114:Tubgcp2 UTSW 7 140007441 missense possibly damaging 0.91
R5435:Tubgcp2 UTSW 7 139996072 missense possibly damaging 0.51
R5531:Tubgcp2 UTSW 7 140005024 intron probably null
R5706:Tubgcp2 UTSW 7 140032225 nonsense probably null
R6123:Tubgcp2 UTSW 7 140007597 missense probably damaging 1.00
R7153:Tubgcp2 UTSW 7 140001036 missense probably benign
R7165:Tubgcp2 UTSW 7 140005361 missense probably damaging 0.99
R7213:Tubgcp2 UTSW 7 140008014 missense probably benign 0.28
R7424:Tubgcp2 UTSW 7 140007924 missense possibly damaging 0.65
R7511:Tubgcp2 UTSW 7 140004880 missense probably benign 0.00
R7523:Tubgcp2 UTSW 7 140006870 missense probably benign 0.08
R7612:Tubgcp2 UTSW 7 140001051 missense probably damaging 1.00
R7951:Tubgcp2 UTSW 7 140007980 missense possibly damaging 0.69
R8220:Tubgcp2 UTSW 7 140006140 missense possibly damaging 0.92
X0004:Tubgcp2 UTSW 7 140007021 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TGCTGAGAAATAAGGCGGCC -3'
(R):5'- AAGAGATCACAGGCCCATTG -3'

Sequencing Primer
(F):5'- GGCCCTTGAAAGCTTCACAG -3'
(R):5'- TGGCAACATACAGGCAATAGGGTAC -3'
Posted On2016-11-21