Incidental Mutation 'R5797:Nxpe4'
ID447277
Institutional Source Beutler Lab
Gene Symbol Nxpe4
Ensembl Gene ENSMUSG00000044229
Gene Nameneurexophilin and PC-esterase domain family, member 4
Synonyms
MMRRC Submission 043209-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R5797 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location48162023-48400025 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 48396538 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 314 (I314N)
Ref Sequence ENSEMBL: ENSMUSP00000149644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093853] [ENSMUST00000215780] [ENSMUST00000216998]
Predicted Effect possibly damaging
Transcript: ENSMUST00000093853
AA Change: I314N

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000091375
Gene: ENSMUSG00000044229
AA Change: I314N

DomainStartEndE-ValueType
transmembrane domain 9 26 N/A INTRINSIC
Pfam:Neurexophilin 74 272 8.9e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215780
AA Change: I314N

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216998
AA Change: I314N

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217002
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik A T 8: 36,498,415 K30* probably null Het
Abhd18 T C 3: 40,933,551 F277L probably benign Het
Acsf2 A G 11: 94,571,679 V170A probably damaging Het
Amz2 G T 11: 109,427,079 probably benign Het
Atp4a A G 7: 30,712,649 Y65C probably damaging Het
Canx T C 11: 50,301,017 I356V probably benign Het
Cfap54 T A 10: 92,967,576 T1535S probably benign Het
Cts3 A T 13: 61,568,392 W52R probably damaging Het
Cyb5rl A T 4: 107,084,207 E276D possibly damaging Het
Dhx30 T C 9: 110,098,820 N78S probably damaging Het
Dmap1 A T 4: 117,675,480 V333E possibly damaging Het
Dnah10 A G 5: 124,821,386 E3744G probably benign Het
Efcab6 C T 15: 83,924,277 C828Y possibly damaging Het
Fam227b A C 2: 126,007,334 I326S probably benign Het
Fbrs C A 7: 127,487,291 H604Q probably damaging Het
Fshr T G 17: 89,011,075 N129T probably damaging Het
Gja3 T C 14: 57,035,713 R401G probably damaging Het
Gm572 G A 4: 148,666,798 M209I probably benign Het
Gne G A 4: 44,060,030 T121M probably damaging Het
Gnmt T C 17: 46,726,379 N160D probably damaging Het
Kalrn T C 16: 34,212,249 Y1125C probably damaging Het
Kif2a A T 13: 106,975,376 C524S probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Lrrtm2 C T 18: 35,213,706 R181H probably damaging Het
Mkln1 A G 6: 31,433,069 D214G probably benign Het
Muc5b C A 7: 141,851,582 T909N unknown Het
Myh13 T A 11: 67,335,002 D335E possibly damaging Het
Myo5b A G 18: 74,701,521 E884G probably benign Het
Naip1 T C 13: 100,444,526 D71G possibly damaging Het
Pcnt T C 10: 76,392,756 E1525G probably benign Het
Pkd1 T A 17: 24,592,641 H153Q possibly damaging Het
Prkdc T A 16: 15,737,834 Y2157* probably null Het
Scd3 T C 19: 44,215,511 I46T probably benign Het
Sdha A T 13: 74,334,357 M279K probably damaging Het
Slco4c1 A G 1: 96,819,104 V671A probably benign Het
Slitrk3 T A 3: 73,048,629 T937S probably damaging Het
Sncaip A T 18: 52,898,204 T442S probably benign Het
Sptb T C 12: 76,603,699 D1748G possibly damaging Het
Vmn2r12 A T 5: 109,085,870 C825* probably null Het
Other mutations in Nxpe4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01618:Nxpe4 APN 9 48394140 missense possibly damaging 0.63
IGL01723:Nxpe4 APN 9 48398598 missense probably benign 0.00
IGL03008:Nxpe4 APN 9 48393438 missense probably benign 0.01
IGL03022:Nxpe4 APN 9 48393248 missense probably damaging 0.99
IGL03271:Nxpe4 APN 9 48393045 missense probably damaging 0.99
R0633:Nxpe4 UTSW 9 48396597 missense probably benign
R1033:Nxpe4 UTSW 9 48393233 missense probably damaging 1.00
R1186:Nxpe4 UTSW 9 48393392 missense probably benign 0.23
R1296:Nxpe4 UTSW 9 48396493 missense probably benign 0.00
R1596:Nxpe4 UTSW 9 48396555 missense probably damaging 0.97
R1813:Nxpe4 UTSW 9 48393378 missense possibly damaging 0.87
R2511:Nxpe4 UTSW 9 48393233 missense probably damaging 1.00
R2902:Nxpe4 UTSW 9 48394146 missense probably benign 0.00
R4229:Nxpe4 UTSW 9 48392822 missense possibly damaging 0.80
R4230:Nxpe4 UTSW 9 48392822 missense possibly damaging 0.80
R4231:Nxpe4 UTSW 9 48398837 missense probably damaging 1.00
R4233:Nxpe4 UTSW 9 48398837 missense probably damaging 1.00
R4236:Nxpe4 UTSW 9 48398837 missense probably damaging 1.00
R4296:Nxpe4 UTSW 9 48398984 missense probably damaging 0.98
R5016:Nxpe4 UTSW 9 48392885 missense probably benign 0.12
R5644:Nxpe4 UTSW 9 48392750 missense probably benign 0.00
R5979:Nxpe4 UTSW 9 48396562 missense probably benign 0.02
R6170:Nxpe4 UTSW 9 48392804 missense probably benign 0.12
R6208:Nxpe4 UTSW 9 48393378 missense probably benign 0.12
R6431:Nxpe4 UTSW 9 48392845 missense probably damaging 0.99
R7475:Nxpe4 UTSW 9 48393340 nonsense probably null
R8093:Nxpe4 UTSW 9 48396552 missense probably benign 0.03
R8103:Nxpe4 UTSW 9 48392720 missense probably benign
R8185:Nxpe4 UTSW 9 48393209 missense possibly damaging 0.89
X0062:Nxpe4 UTSW 9 48399025 missense probably benign
Predicted Primers PCR Primer
(F):5'- CACATCAGAGGAAAGTTTTACTGAG -3'
(R):5'- AGCCTTGAATAGCTTATACTGAGAC -3'

Sequencing Primer
(F):5'- TCCAACGGGCTCTTTGAA -3'
(R):5'- CTGAGACATACTGTTGACTTTGC -3'
Posted On2016-12-15