Incidental Mutation 'R5797:Slco4c1'
ID447260
Institutional Source Beutler Lab
Gene Symbol Slco4c1
Ensembl Gene ENSMUSG00000040693
Gene Namesolute carrier organic anion transporter family, member 4C1
SynonymsOATP-H, OATP4C1, PRO2176, OATP-M1, SLC21A20, C330017E21Rik
MMRRC Submission 043209-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.220) question?
Stock #R5797 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location96816270-96872171 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96819104 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 671 (V671A)
Ref Sequence ENSEMBL: ENSMUSP00000071875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071985]
Predicted Effect probably benign
Transcript: ENSMUST00000071985
AA Change: V671A

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000071875
Gene: ENSMUSG00000040693
AA Change: V671A

DomainStartEndE-ValueType
low complexity region 55 72 N/A INTRINSIC
Pfam:MFS_1 102 483 1.3e-19 PFAM
KAZAL 503 547 1.67e-1 SMART
transmembrane domain 666 688 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLCO4C1 belongs to the organic anion transporter (OATP) family. OATPs are involved in the membrane transport of bile acids, conjugated steroids, thyroid hormone, eicosanoids, peptides, and numerous drugs in many tissues (Mikkaichi et al., 2004 [PubMed 14993604]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik A T 8: 36,498,415 K30* probably null Het
Abhd18 T C 3: 40,933,551 F277L probably benign Het
Acsf2 A G 11: 94,571,679 V170A probably damaging Het
Amz2 G T 11: 109,427,079 probably benign Het
Atp4a A G 7: 30,712,649 Y65C probably damaging Het
Canx T C 11: 50,301,017 I356V probably benign Het
Cfap54 T A 10: 92,967,576 T1535S probably benign Het
Cts3 A T 13: 61,568,392 W52R probably damaging Het
Cyb5rl A T 4: 107,084,207 E276D possibly damaging Het
Dhx30 T C 9: 110,098,820 N78S probably damaging Het
Dmap1 A T 4: 117,675,480 V333E possibly damaging Het
Dnah10 A G 5: 124,821,386 E3744G probably benign Het
Efcab6 C T 15: 83,924,277 C828Y possibly damaging Het
Fam227b A C 2: 126,007,334 I326S probably benign Het
Fbrs C A 7: 127,487,291 H604Q probably damaging Het
Fshr T G 17: 89,011,075 N129T probably damaging Het
Gja3 T C 14: 57,035,713 R401G probably damaging Het
Gm572 G A 4: 148,666,798 M209I probably benign Het
Gne G A 4: 44,060,030 T121M probably damaging Het
Gnmt T C 17: 46,726,379 N160D probably damaging Het
Kalrn T C 16: 34,212,249 Y1125C probably damaging Het
Kif2a A T 13: 106,975,376 C524S probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Lrrtm2 C T 18: 35,213,706 R181H probably damaging Het
Mkln1 A G 6: 31,433,069 D214G probably benign Het
Muc5b C A 7: 141,851,582 T909N unknown Het
Myh13 T A 11: 67,335,002 D335E possibly damaging Het
Myo5b A G 18: 74,701,521 E884G probably benign Het
Naip1 T C 13: 100,444,526 D71G possibly damaging Het
Nxpe4 T A 9: 48,396,538 I314N possibly damaging Het
Pcnt T C 10: 76,392,756 E1525G probably benign Het
Pkd1 T A 17: 24,592,641 H153Q possibly damaging Het
Prkdc T A 16: 15,737,834 Y2157* probably null Het
Scd3 T C 19: 44,215,511 I46T probably benign Het
Sdha A T 13: 74,334,357 M279K probably damaging Het
Slitrk3 T A 3: 73,048,629 T937S probably damaging Het
Sncaip A T 18: 52,898,204 T442S probably benign Het
Sptb T C 12: 76,603,699 D1748G possibly damaging Het
Vmn2r12 A T 5: 109,085,870 C825* probably null Het
Other mutations in Slco4c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Slco4c1 APN 1 96841187 missense probably damaging 0.99
IGL01510:Slco4c1 APN 1 96867953 missense probably damaging 1.00
IGL01674:Slco4c1 APN 1 96842493 missense probably damaging 1.00
IGL02444:Slco4c1 APN 1 96844509 missense probably damaging 1.00
IGL03355:Slco4c1 APN 1 96842507 nonsense probably null
H8562:Slco4c1 UTSW 1 96842485 missense probably benign 0.01
H8786:Slco4c1 UTSW 1 96841151 missense probably damaging 1.00
R0350:Slco4c1 UTSW 1 96828849 missense probably benign 0.18
R0463:Slco4c1 UTSW 1 96867920 missense possibly damaging 0.93
R0550:Slco4c1 UTSW 1 96867859 missense probably damaging 1.00
R1122:Slco4c1 UTSW 1 96828836 missense possibly damaging 0.89
R1205:Slco4c1 UTSW 1 96867888 missense probably damaging 1.00
R1215:Slco4c1 UTSW 1 96828871 missense probably damaging 1.00
R1466:Slco4c1 UTSW 1 96841172 missense probably damaging 0.97
R1466:Slco4c1 UTSW 1 96841172 missense probably damaging 0.97
R1907:Slco4c1 UTSW 1 96842499 missense probably damaging 1.00
R1960:Slco4c1 UTSW 1 96867929 missense probably benign 0.00
R2372:Slco4c1 UTSW 1 96821200 missense probably benign 0.00
R3424:Slco4c1 UTSW 1 96841251 missense probably benign 0.02
R3425:Slco4c1 UTSW 1 96841251 missense probably benign 0.02
R4292:Slco4c1 UTSW 1 96844656 critical splice acceptor site probably null
R4656:Slco4c1 UTSW 1 96841245 missense probably benign 0.01
R4852:Slco4c1 UTSW 1 96841228 missense probably damaging 1.00
R4854:Slco4c1 UTSW 1 96841228 missense probably damaging 1.00
R4865:Slco4c1 UTSW 1 96841228 missense probably damaging 1.00
R4867:Slco4c1 UTSW 1 96841228 missense probably damaging 1.00
R4898:Slco4c1 UTSW 1 96837512 missense probably damaging 1.00
R4900:Slco4c1 UTSW 1 96841228 missense probably damaging 1.00
R5023:Slco4c1 UTSW 1 96841228 missense probably damaging 1.00
R5074:Slco4c1 UTSW 1 96841228 missense probably damaging 1.00
R5348:Slco4c1 UTSW 1 96842529 missense probably damaging 0.99
R5356:Slco4c1 UTSW 1 96832110 missense probably damaging 1.00
R5471:Slco4c1 UTSW 1 96872045 missense probably benign 0.34
R5683:Slco4c1 UTSW 1 96867834 missense probably damaging 1.00
R5801:Slco4c1 UTSW 1 96872084 missense probably damaging 0.96
R5837:Slco4c1 UTSW 1 96818982 missense probably benign 0.40
R6242:Slco4c1 UTSW 1 96839283 missense probably damaging 0.99
R7014:Slco4c1 UTSW 1 96823781 splice site probably null
R7112:Slco4c1 UTSW 1 96841141 missense probably damaging 1.00
R7174:Slco4c1 UTSW 1 96837598 missense possibly damaging 0.87
R7265:Slco4c1 UTSW 1 96871793 missense probably damaging 0.99
R7275:Slco4c1 UTSW 1 96871772 missense probably benign 0.38
R7305:Slco4c1 UTSW 1 96828965 missense probably damaging 1.00
R7428:Slco4c1 UTSW 1 96837520 missense possibly damaging 0.68
R7649:Slco4c1 UTSW 1 96828942 missense probably benign 0.03
R7980:Slco4c1 UTSW 1 96836925 missense probably benign 0.20
R8137:Slco4c1 UTSW 1 96821245 missense probably damaging 1.00
R8188:Slco4c1 UTSW 1 96844536 missense probably damaging 1.00
Z1176:Slco4c1 UTSW 1 96821230 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTTCTCACAGGCAGGAGC -3'
(R):5'- ATCATACTCAGCCTCTGTTGTGG -3'

Sequencing Primer
(F):5'- GCAGGAGCCAGTTCCCAAAG -3'
(R):5'- CAGCCTCTGTTGTGGTATAAAATTTG -3'
Posted On2016-12-15