Incidental Mutation 'R5797:Gm572'
ID447266
Institutional Source Beutler Lab
Gene Symbol Gm572
Ensembl Gene ENSMUSG00000070577
Gene Namepredicted gene 572
Synonymsb2b1167Clo, LOC230909
MMRRC Submission 043209-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R5797 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location148643317-148671572 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 148666798 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 209 (M209I)
Ref Sequence ENSEMBL: ENSMUSP00000101323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105698]
AlphaFold B1ARY8
Predicted Effect probably benign
Transcript: ENSMUST00000105698
AA Change: M209I

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000101323
Gene: ENSMUSG00000070577
AA Change: M209I

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:DUF4556 144 358 1.9e-117 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele show cardiovascular defects including double outlet right ventricle, dextrocardia and atrioventricular septal defects, heterotaxia with situs inversus totalis and right pulmonary isomerism, spleen hypoplasia, mid-line liver, and immotile respiratory cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik A T 8: 36,498,415 K30* probably null Het
Abhd18 T C 3: 40,933,551 F277L probably benign Het
Acsf2 A G 11: 94,571,679 V170A probably damaging Het
Amz2 G T 11: 109,427,079 probably benign Het
Atp4a A G 7: 30,712,649 Y65C probably damaging Het
Canx T C 11: 50,301,017 I356V probably benign Het
Cfap54 T A 10: 92,967,576 T1535S probably benign Het
Cts3 A T 13: 61,568,392 W52R probably damaging Het
Cyb5rl A T 4: 107,084,207 E276D possibly damaging Het
Dhx30 T C 9: 110,098,820 N78S probably damaging Het
Dmap1 A T 4: 117,675,480 V333E possibly damaging Het
Dnah10 A G 5: 124,821,386 E3744G probably benign Het
Efcab6 C T 15: 83,924,277 C828Y possibly damaging Het
Fam227b A C 2: 126,007,334 I326S probably benign Het
Fbrs C A 7: 127,487,291 H604Q probably damaging Het
Fshr T G 17: 89,011,075 N129T probably damaging Het
Gja3 T C 14: 57,035,713 R401G probably damaging Het
Gne G A 4: 44,060,030 T121M probably damaging Het
Gnmt T C 17: 46,726,379 N160D probably damaging Het
Kalrn T C 16: 34,212,249 Y1125C probably damaging Het
Kif2a A T 13: 106,975,376 C524S probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Lrrtm2 C T 18: 35,213,706 R181H probably damaging Het
Mkln1 A G 6: 31,433,069 D214G probably benign Het
Muc5b C A 7: 141,851,582 T909N unknown Het
Myh13 T A 11: 67,335,002 D335E possibly damaging Het
Myo5b A G 18: 74,701,521 E884G probably benign Het
Naip1 T C 13: 100,444,526 D71G possibly damaging Het
Nxpe4 T A 9: 48,396,538 I314N possibly damaging Het
Pcnt T C 10: 76,392,756 E1525G probably benign Het
Pkd1 T A 17: 24,592,641 H153Q possibly damaging Het
Prkdc T A 16: 15,737,834 Y2157* probably null Het
Scd3 T C 19: 44,215,511 I46T probably benign Het
Sdha A T 13: 74,334,357 M279K probably damaging Het
Slco4c1 A G 1: 96,819,104 V671A probably benign Het
Slitrk3 T A 3: 73,048,629 T937S probably damaging Het
Sncaip A T 18: 52,898,204 T442S probably benign Het
Sptb T C 12: 76,603,699 D1748G possibly damaging Het
Vmn2r12 A T 5: 109,085,870 C825* probably null Het
Other mutations in Gm572
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Gm572 APN 4 148667392 missense possibly damaging 0.93
IGL01766:Gm572 APN 4 148654895 missense possibly damaging 0.53
IGL02670:Gm572 APN 4 148651228 missense probably benign
IGL02716:Gm572 APN 4 148654870 missense probably benign 0.01
PIT1430001:Gm572 UTSW 4 148671393 missense unknown
R1346:Gm572 UTSW 4 148654897 missense possibly damaging 0.96
R1546:Gm572 UTSW 4 148666819 missense possibly damaging 0.71
R1564:Gm572 UTSW 4 148651186 missense possibly damaging 0.53
R1672:Gm572 UTSW 4 148668509 missense possibly damaging 0.86
R2516:Gm572 UTSW 4 148664384 missense possibly damaging 0.93
R3852:Gm572 UTSW 4 148668872 missense possibly damaging 0.71
R4366:Gm572 UTSW 4 148654865 missense possibly damaging 0.85
R4884:Gm572 UTSW 4 148667362 missense possibly damaging 0.85
R4888:Gm572 UTSW 4 148666845 critical splice donor site probably null
R5026:Gm572 UTSW 4 148654844 missense possibly damaging 0.92
R5121:Gm572 UTSW 4 148666845 critical splice donor site probably null
R5988:Gm572 UTSW 4 148668507 missense possibly damaging 0.85
R6827:Gm572 UTSW 4 148658086 missense possibly damaging 0.96
R7709:Gm572 UTSW 4 148668951 missense probably damaging 0.98
R8298:Gm572 UTSW 4 148658093 missense possibly damaging 0.53
R8442:Gm572 UTSW 4 148658993 missense possibly damaging 0.53
R8906:Gm572 UTSW 4 148666833 missense probably benign 0.32
R9066:Gm572 UTSW 4 148666821 missense possibly damaging 0.52
RF029:Gm572 UTSW 4 148671393 frame shift probably null
RF030:Gm572 UTSW 4 148671393 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GAGTATCCTCCAAGTACCCATG -3'
(R):5'- CGGTGCACTTTACGCTAATG -3'

Sequencing Primer
(F):5'- ATGTTCCTTGGCCCAGAGTGAC -3'
(R):5'- TGGAGCCCAATTTTCGAAGC -3'
Posted On2016-12-15