Incidental Mutation 'R5818:Rab11fip3'
ID449192
Institutional Source Beutler Lab
Gene Symbol Rab11fip3
Ensembl Gene ENSMUSG00000037098
Gene NameRAB11 family interacting protein 3 (class II)
SynonymsD030060O14Rik, Rab11-FIP3
MMRRC Submission 043398-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5818 (G1)
Quality Score170
Status Validated
Chromosome17
Chromosomal Location25989036-26069409 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26016116 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 608 (S608G)
Ref Sequence ENSEMBL: ENSMUSP00000113521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118828] [ENSMUST00000120691] [ENSMUST00000122103] [ENSMUST00000148021]
Predicted Effect probably damaging
Transcript: ENSMUST00000118828
AA Change: S5G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113048
Gene: ENSMUSG00000037098
AA Change: S5G

DomainStartEndE-ValueType
low complexity region 136 148 N/A INTRINSIC
low complexity region 313 333 N/A INTRINSIC
Blast:BRLZ 335 385 2e-11 BLAST
Pfam:RBD-FIP 404 444 2.8e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120691
AA Change: S608G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112875
Gene: ENSMUSG00000037098
AA Change: S608G

DomainStartEndE-ValueType
internal_repeat_1 29 130 3.12e-31 PROSPERO
internal_repeat_1 144 294 3.12e-31 PROSPERO
EFh 500 528 3.03e-1 SMART
EFh 532 560 3.86e1 SMART
low complexity region 739 751 N/A INTRINSIC
low complexity region 916 936 N/A INTRINSIC
Blast:BRLZ 938 988 2e-11 BLAST
Pfam:RBD-FIP 1007 1047 4.7e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122103
AA Change: S608G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113521
Gene: ENSMUSG00000037098
AA Change: S608G

DomainStartEndE-ValueType
internal_repeat_1 29 130 2.03e-32 PROSPERO
internal_repeat_1 144 294 2.03e-32 PROSPERO
EFh 500 528 3.03e-1 SMART
EFh 532 560 3.86e1 SMART
low complexity region 784 796 N/A INTRINSIC
low complexity region 961 981 N/A INTRINSIC
Blast:BRLZ 983 1033 2e-11 BLAST
Pfam:RBD-FIP 1052 1092 4.9e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144587
Predicted Effect probably damaging
Transcript: ENSMUST00000148021
AA Change: S27G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Meta Mutation Damage Score 0.1118 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins of the large Rab GTPase family (see RAB1A; MIM 179508) have regulatory roles in the formation, targeting, and fusion of intracellular transport vesicles. RAB11FIP3 is one of many proteins that interact with and regulate Rab GTPases (Hales et al., 2001 [PubMed 11495908]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,219,643 V560D probably damaging Het
Actn4 A G 7: 28,919,019 I72T probably damaging Het
Adam33 A T 2: 131,054,358 C440S possibly damaging Het
Bace1 T C 9: 45,859,049 I361T possibly damaging Het
Bend6 T C 1: 33,883,573 probably benign Het
Bpifb9a T G 2: 154,262,295 N219K probably damaging Het
Cacna1g C A 11: 94,418,120 K1634N probably damaging Het
Ccdc155 C T 7: 45,193,959 probably null Het
Cdk18 A G 1: 132,119,098 probably null Het
Chrng G A 1: 87,209,801 V320I probably benign Het
Corin G T 5: 72,435,395 H87N probably benign Het
Cps1 A T 1: 67,166,488 I557F possibly damaging Het
Cyp4a29 T C 4: 115,247,032 V99A possibly damaging Het
Dach1 T C 14: 98,168,684 D209G probably damaging Het
Dgat1 G A 15: 76,502,207 probably benign Het
Fbxw26 G T 9: 109,732,566 R187S probably benign Het
Gabrd G A 4: 155,388,361 P122S probably damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm8300 T G 12: 87,517,060 V55G possibly damaging Het
Hif1a A G 12: 73,939,564 Q343R possibly damaging Het
Hyou1 G A 9: 44,388,926 probably null Het
Igfn1 A T 1: 135,966,126 I2072K possibly damaging Het
Kctd8 C T 5: 69,296,711 A328T probably benign Het
Krt10 A G 11: 99,388,771 Y188H probably damaging Het
Krtap4-16 T A 11: 99,851,523 Q17L unknown Het
Larp4b T A 13: 9,158,560 S416R probably benign Het
Lmtk2 G A 5: 144,156,900 V232M probably benign Het
Mroh4 A G 15: 74,611,982 I571T probably damaging Het
Myo15 G A 11: 60,497,951 R2021Q probably benign Het
Npl G A 1: 153,535,915 R63C probably damaging Het
Ntn4 A G 10: 93,644,764 I80V probably benign Het
Numb C T 12: 83,825,254 probably null Het
Nusap1 A C 2: 119,635,513 M205L possibly damaging Het
Olfr149 T C 9: 39,702,365 S135G probably benign Het
Onecut2 T A 18: 64,340,975 M180K possibly damaging Het
Pmfbp1 T C 8: 109,538,679 probably null Het
Ppfia1 T C 7: 144,520,568 probably benign Het
Ppm1b A G 17: 84,993,719 K9R probably benign Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
Sohlh2 A G 3: 55,190,501 T125A probably damaging Het
Ssfa2 T A 2: 79,644,593 S299T probably damaging Het
Tet1 C A 10: 62,816,408 M1610I possibly damaging Het
Tgfbr3 A T 5: 107,133,003 D630E probably benign Het
Thnsl2 T C 6: 71,134,143 D247G probably benign Het
Tmem198b G A 10: 128,802,188 R169W probably benign Het
Tmem201 G A 4: 149,727,392 A332V probably benign Het
Tsku T C 7: 98,352,098 D342G possibly damaging Het
Ucn2 A T 9: 108,986,497 H109L probably benign Het
Virma T G 4: 11,513,319 L391R possibly damaging Het
Vmn1r60 T A 7: 5,545,099 M1L probably benign Het
Vmn2r76 T C 7: 86,229,934 H386R probably benign Het
Zfp608 C T 18: 54,895,396 R1315Q probably benign Het
Zmym2 A G 14: 56,946,529 T983A probably benign Het
Zscan26 A G 13: 21,445,761 S65P probably benign Het
Other mutations in Rab11fip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Rab11fip3 APN 17 25991809 splice site probably benign
IGL00420:Rab11fip3 APN 17 26067625 missense probably benign 0.20
IGL01291:Rab11fip3 APN 17 26016113 missense probably damaging 0.99
IGL01473:Rab11fip3 APN 17 26068735 missense possibly damaging 0.53
IGL01687:Rab11fip3 APN 17 26067982 missense possibly damaging 0.96
IGL01764:Rab11fip3 APN 17 26068693 missense probably benign 0.02
IGL01977:Rab11fip3 APN 17 26068003 missense possibly damaging 0.72
IGL02140:Rab11fip3 APN 17 26067892 missense probably benign 0.33
IGL02434:Rab11fip3 APN 17 26068835 missense possibly damaging 0.85
IGL02549:Rab11fip3 APN 17 25994320 missense probably damaging 0.96
IGL02889:Rab11fip3 APN 17 26067679 missense possibly damaging 0.84
IGL02953:Rab11fip3 APN 17 26067679 missense possibly damaging 0.84
ANU05:Rab11fip3 UTSW 17 26016113 missense probably damaging 0.99
R0193:Rab11fip3 UTSW 17 25990999 missense probably damaging 0.99
R0388:Rab11fip3 UTSW 17 26069072 missense probably benign 0.33
R0543:Rab11fip3 UTSW 17 25994225 missense probably damaging 1.00
R0678:Rab11fip3 UTSW 17 26068847 missense probably benign 0.00
R1283:Rab11fip3 UTSW 17 26004554 missense probably damaging 1.00
R1473:Rab11fip3 UTSW 17 25991322 missense probably damaging 1.00
R1625:Rab11fip3 UTSW 17 26068891 missense possibly damaging 0.72
R1973:Rab11fip3 UTSW 17 26024391 missense probably damaging 0.97
R2160:Rab11fip3 UTSW 17 26069054 missense probably benign 0.33
R2197:Rab11fip3 UTSW 17 26068178 missense probably benign
R2382:Rab11fip3 UTSW 17 25990867 nonsense probably null
R3028:Rab11fip3 UTSW 17 26015942 critical splice donor site probably null
R3797:Rab11fip3 UTSW 17 26068526 missense possibly damaging 0.73
R4012:Rab11fip3 UTSW 17 26068028 frame shift probably null
R4064:Rab11fip3 UTSW 17 26024394 missense probably damaging 0.97
R4478:Rab11fip3 UTSW 17 26016083 missense probably damaging 1.00
R4527:Rab11fip3 UTSW 17 26036657 missense probably damaging 1.00
R4565:Rab11fip3 UTSW 17 26068706 missense possibly damaging 0.73
R5048:Rab11fip3 UTSW 17 26067580 critical splice donor site probably null
R5138:Rab11fip3 UTSW 17 25991026 missense probably benign 0.32
R5317:Rab11fip3 UTSW 17 26068078 missense possibly damaging 0.72
R5453:Rab11fip3 UTSW 17 25992581 critical splice donor site probably null
R5495:Rab11fip3 UTSW 17 26016143 missense probably damaging 0.99
R5525:Rab11fip3 UTSW 17 25991295 missense probably damaging 1.00
R5654:Rab11fip3 UTSW 17 26016064 missense probably damaging 1.00
R5716:Rab11fip3 UTSW 17 26036664 missense probably damaging 1.00
R6044:Rab11fip3 UTSW 17 26067869 missense possibly damaging 0.93
R6716:Rab11fip3 UTSW 17 25991057 missense probably damaging 1.00
R6785:Rab11fip3 UTSW 17 25991718 missense probably damaging 0.99
R7161:Rab11fip3 UTSW 17 26069090 missense probably benign 0.09
R7390:Rab11fip3 UTSW 17 26068152 missense possibly damaging 0.81
R7447:Rab11fip3 UTSW 17 26068874 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- CCTGGGAGCAGCAGCAAT -3'
(R):5'- AAGCCAGTGTTGATGTTTAGGGA -3'

Sequencing Primer
(F):5'- AATGCACCATGGTCAGGCTC -3'
(R):5'- GATAGCTATATCAGGCTCCTGTCAG -3'
Posted On2016-12-20