Mutagenetix > Incidental Mutation

Incidental Mutation 'R5525:Rab11fip3'

431826

Institutional Source

Beutler Lab

Gene Symbol

Rab11fip3

Ensembl Gene

ENSMUSG00000037098

Gene Name

RAB11 family interacting protein 3 (class II)

Synonyms

D030060O14Rik, Rab11-FIP3

MMRRC Submission

043083-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5525 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

25989036-26069409 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 25991295 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 996 (E996G)

Ref Sequence

ENSEMBL: ENSMUSP00000113521 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000118828] [ENSMUST00000120691] [ENSMUST00000122103]

AlphaFold

Q8CHD8

Predicted Effect

probably damaging
Transcript: ENSMUST00000118828
AA Change: E348G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113048
Gene: ENSMUSG00000037098
AA Change: E348G

Domain	Start	End	E-Value	Type
low complexity region	136	148	N/A	INTRINSIC
low complexity region	313	333	N/A	INTRINSIC
Blast:BRLZ	335	385	2e-11	BLAST
Pfam:RBD-FIP	404	444	2.8e-18	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000120691
AA Change: E951G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112875
Gene: ENSMUSG00000037098
AA Change: E951G

Domain	Start	End	E-Value	Type
internal_repeat_1	29	130	3.12e-31	PROSPERO
internal_repeat_1	144	294	3.12e-31	PROSPERO
EFh	500	528	3.03e-1	SMART
EFh	532	560	3.86e1	SMART
low complexity region	739	751	N/A	INTRINSIC
low complexity region	916	936	N/A	INTRINSIC
Blast:BRLZ	938	988	2e-11	BLAST
Pfam:RBD-FIP	1007	1047	4.7e-18	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000122103
AA Change: E996G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113521
Gene: ENSMUSG00000037098
AA Change: E996G

Domain	Start	End	E-Value	Type
internal_repeat_1	29	130	2.03e-32	PROSPERO
internal_repeat_1	144	294	2.03e-32	PROSPERO
EFh	500	528	3.03e-1	SMART
EFh	532	560	3.86e1	SMART
low complexity region	784	796	N/A	INTRINSIC
low complexity region	961	981	N/A	INTRINSIC
Blast:BRLZ	983	1033	2e-11	BLAST
Pfam:RBD-FIP	1052	1092	4.9e-18	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180932

Coding Region Coverage

1x: 98.3%
3x: 97.3%
10x: 95.2%
20x: 90.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins of the large Rab GTPase family (see RAB1A; MIM 179508) have regulatory roles in the formation, targeting, and fusion of intracellular transport vesicles. RAB11FIP3 is one of many proteins that interact with and regulate Rab GTPases (Hales et al., 2001 [PubMed 11495908]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acan	A	G	7: 79,099,983	T1501A	probably benign	Het
Acin1	G	A	14: 54,664,391	A648V	possibly damaging	Het
Agap1	A	G	1: 89,743,773	T401A	possibly damaging	Het
Anapc4	T	G	5: 52,856,809	M440R	probably damaging	Het
Ankrd26	A	G	6: 118,527,731	M739T	probably benign	Het
Brip1	T	C	11: 86,110,447	E721G	possibly damaging	Het
Bzw1	A	G	1: 58,402,906	E221G	possibly damaging	Het
Cenpm	A	C	15: 82,239,291		probably null	Het
Exosc1	T	A	19: 41,924,018	K143N	probably damaging	Het
Fgd5	T	A	6: 92,066,247	L1236Q	probably damaging	Het
Gemin6	T	G	17: 80,227,749	V46G	probably damaging	Het
Grm3	C	T	5: 9,504,872	V807I	probably damaging	Het
Kndc1	A	G	7: 139,924,111	N1110S	probably benign	Het
Magi1	A	T	6: 93,792,373	V17D	possibly damaging	Het
Mdn1	T	G	4: 32,767,961	M5298R	possibly damaging	Het
Nlrp9c	T	A	7: 26,384,501	E551V	probably damaging	Het
Oacyl	A	C	18: 65,745,356	I457L	probably benign	Het
Olfr103	C	T	17: 37,336,626	G202D	probably damaging	Het
Olfr1102	A	T	2: 87,002,339	E123D	possibly damaging	Het
Olfr494	A	G	7: 108,367,999	I170V	probably benign	Het
Rabep1	T	A	11: 70,923,146	S554T	probably damaging	Het
Rln1	T	C	19: 29,334,520	E26G	probably benign	Het
Rpf1	A	G	3: 146,517,804		silent	Het
Sdk1	T	C	5: 142,185,265	V1961A	possibly damaging	Het
Serpinb8	A	T	1: 107,607,293	I365F	probably damaging	Het
Shank2	A	G	7: 144,070,109	D277G	probably damaging	Het
Snapc4	ACTGCTGCTGCTGCTGCTGC	ACTGCTGCTGCTGCTGC	2: 26,369,526		probably benign	Het
Thsd7a	T	C	6: 12,332,007	T1269A	possibly damaging	Het
Ttll3	A	G	6: 113,412,978	N776D	probably benign	Het
Unc80	A	G	1: 66,606,614	E1483G	possibly damaging	Het
Ush2a	A	G	1: 188,753,606	D2971G	probably benign	Het
Zfp322a	A	G	13: 23,357,515	V19A	probably benign	Het
Zfp462	C	A	4: 55,050,281	P2164T	possibly damaging	Het

Other mutations in Rab11fip3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00419:Rab11fip3	APN	17	25991809	splice site	probably benign
IGL00420:Rab11fip3	APN	17	26067625	missense	probably benign	0.20
IGL01291:Rab11fip3	APN	17	26016113	missense	probably damaging	0.99
IGL01473:Rab11fip3	APN	17	26068735	missense	possibly damaging	0.53
IGL01687:Rab11fip3	APN	17	26067982	missense	probably damaging	0.97
IGL01764:Rab11fip3	APN	17	26068693	missense	probably benign	0.02
IGL01977:Rab11fip3	APN	17	26068003	missense	possibly damaging	0.72
IGL02140:Rab11fip3	APN	17	26067892	missense	probably benign	0.33
IGL02434:Rab11fip3	APN	17	26068835	missense	possibly damaging	0.85
IGL02549:Rab11fip3	APN	17	25994320	missense	probably damaging	0.96
IGL02889:Rab11fip3	APN	17	26067679	missense	possibly damaging	0.84
IGL02953:Rab11fip3	APN	17	26067679	missense	possibly damaging	0.84
ANU05:Rab11fip3	UTSW	17	26016113	missense	probably damaging	0.99
R0193:Rab11fip3	UTSW	17	25990999	missense	probably damaging	0.99
R0388:Rab11fip3	UTSW	17	26069072	missense	probably benign	0.33
R0543:Rab11fip3	UTSW	17	25994225	missense	probably damaging	1.00
R0678:Rab11fip3	UTSW	17	26068847	missense	probably benign	0.00
R1283:Rab11fip3	UTSW	17	26004554	missense	probably damaging	1.00
R1473:Rab11fip3	UTSW	17	25991322	missense	probably damaging	1.00
R1625:Rab11fip3	UTSW	17	26068891	missense	possibly damaging	0.72
R1973:Rab11fip3	UTSW	17	26024391	missense	probably damaging	0.97
R2160:Rab11fip3	UTSW	17	26069054	missense	probably benign	0.33
R2197:Rab11fip3	UTSW	17	26068178	missense	probably benign
R2382:Rab11fip3	UTSW	17	25990867	nonsense	probably null
R3028:Rab11fip3	UTSW	17	26015942	critical splice donor site	probably null
R3797:Rab11fip3	UTSW	17	26068526	missense	possibly damaging	0.73
R4012:Rab11fip3	UTSW	17	26068028	frame shift	probably null
R4064:Rab11fip3	UTSW	17	26024394	missense	probably damaging	0.97
R4478:Rab11fip3	UTSW	17	26016083	missense	probably damaging	1.00
R4527:Rab11fip3	UTSW	17	26036657	missense	probably damaging	1.00
R4565:Rab11fip3	UTSW	17	26068706	missense	possibly damaging	0.73
R5048:Rab11fip3	UTSW	17	26067580	critical splice donor site	probably null
R5138:Rab11fip3	UTSW	17	25991026	missense	probably benign	0.32
R5317:Rab11fip3	UTSW	17	26068078	missense	possibly damaging	0.72
R5453:Rab11fip3	UTSW	17	25992581	critical splice donor site	probably null
R5495:Rab11fip3	UTSW	17	26016143	missense	probably damaging	0.99
R5654:Rab11fip3	UTSW	17	26016064	missense	probably damaging	1.00
R5716:Rab11fip3	UTSW	17	26036664	missense	probably damaging	1.00
R5818:Rab11fip3	UTSW	17	26016116	missense	probably damaging	1.00
R6044:Rab11fip3	UTSW	17	26067869	missense	possibly damaging	0.93
R6716:Rab11fip3	UTSW	17	25991057	missense	probably damaging	1.00
R6785:Rab11fip3	UTSW	17	25991718	missense	probably damaging	0.99
R7161:Rab11fip3	UTSW	17	26069090	missense	probably benign	0.09
R7390:Rab11fip3	UTSW	17	26068152	missense	possibly damaging	0.81
R7447:Rab11fip3	UTSW	17	26068874	missense	possibly damaging	0.66
R7836:Rab11fip3	UTSW	17	26068258	missense	possibly damaging	0.82
R7981:Rab11fip3	UTSW	17	25997989	missense	probably damaging	0.98
R8008:Rab11fip3	UTSW	17	26067982	missense	probably damaging	0.97
R8887:Rab11fip3	UTSW	17	26067953	missense	possibly damaging	0.83
R8962:Rab11fip3	UTSW	17	26012033	missense	probably damaging	1.00
R9250:Rab11fip3	UTSW	17	26018245	missense	unknown
R9329:Rab11fip3	UTSW	17	26012058	missense	probably benign	0.15
R9506:Rab11fip3	UTSW	17	25994276	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTCCTTCAGGTTACGGTTG -3'
(R):5'- GCTTCTTGGAACAGGTTAACGTC -3'

Sequencing Primer
(F):5'- CCTTCAGGTTACGGTTGTCCTAG -3'
(R):5'- TGGAACAGGTTAACGTCCTCCC -3'

Posted On

2016-10-05