Incidental Mutation 'R5838:Ltbp2'
ID449752
Institutional Source Beutler Lab
Gene Symbol Ltbp2
Ensembl Gene ENSMUSG00000002020
Gene Namelatent transforming growth factor beta binding protein 2
Synonyms
MMRRC Submission 044058-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.794) question?
Stock #R5838 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location84783212-84876532 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 84789101 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 1352 (R1352H)
Ref Sequence ENSEMBL: ENSMUSP00000105883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002073] [ENSMUST00000110254] [ENSMUST00000163189] [ENSMUST00000166383]
Predicted Effect probably benign
Transcript: ENSMUST00000002073
AA Change: R1375H

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000002073
Gene: ENSMUSG00000002020
AA Change: R1375H

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
low complexity region 99 108 N/A INTRINSIC
EGF 184 213 6.55e-1 SMART
low complexity region 255 275 N/A INTRINSIC
EGF 384 413 8.19e-2 SMART
low complexity region 515 526 N/A INTRINSIC
Pfam:TB 546 582 3.8e-9 PFAM
EGF_CA 606 646 8.05e-10 SMART
Pfam:TB 666 707 3.4e-17 PFAM
EGF_CA 832 874 7.18e-7 SMART
EGF_CA 875 917 1.75e-10 SMART
EGF_CA 918 957 1.53e-10 SMART
EGF_CA 958 997 3.51e-10 SMART
EGF_CA 998 1038 8.3e-12 SMART
EGF_CA 1039 1080 4.56e-9 SMART
EGF_CA 1081 1122 4.56e-9 SMART
EGF_CA 1123 1163 8.76e-11 SMART
EGF_CA 1164 1205 4.38e-11 SMART
EGF_CA 1206 1246 1.75e-10 SMART
EGF_CA 1247 1290 2.24e-8 SMART
EGF_CA 1291 1332 6.01e-9 SMART
EGF 1336 1375 1.95e1 SMART
Pfam:TB 1410 1450 1.4e-13 PFAM
EGF_CA 1473 1515 2.31e-10 SMART
EGF_CA 1516 1555 7.93e-9 SMART
Pfam:TB 1582 1623 1e-13 PFAM
low complexity region 1691 1704 N/A INTRINSIC
EGF 1724 1761 4e-5 SMART
EGF_CA 1762 1806 1.91e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110254
AA Change: R1352H

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000105883
Gene: ENSMUSG00000002020
AA Change: R1352H

DomainStartEndE-ValueType
low complexity region 119 128 N/A INTRINSIC
EGF 204 233 6.55e-1 SMART
low complexity region 275 295 N/A INTRINSIC
EGF 404 433 8.19e-2 SMART
low complexity region 535 546 N/A INTRINSIC
Pfam:TB 565 602 4e-8 PFAM
EGF_CA 626 666 8.05e-10 SMART
Pfam:TB 685 727 3.7e-16 PFAM
EGF_CA 852 894 7.18e-7 SMART
EGF_CA 895 934 1.53e-10 SMART
EGF_CA 935 974 3.51e-10 SMART
EGF_CA 975 1015 8.3e-12 SMART
EGF_CA 1016 1057 4.56e-9 SMART
EGF_CA 1058 1099 4.56e-9 SMART
EGF_CA 1100 1140 8.76e-11 SMART
EGF_CA 1141 1182 4.38e-11 SMART
EGF_CA 1183 1223 1.75e-10 SMART
EGF_CA 1224 1267 2.24e-8 SMART
EGF_CA 1268 1309 6.01e-9 SMART
EGF 1313 1352 1.95e1 SMART
Pfam:TB 1387 1427 1.4e-11 PFAM
EGF_CA 1450 1492 2.31e-10 SMART
EGF_CA 1493 1532 7.93e-9 SMART
Pfam:TB 1558 1600 4.6e-13 PFAM
low complexity region 1668 1681 N/A INTRINSIC
EGF 1701 1738 4e-5 SMART
EGF_CA 1739 1783 1.91e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163189
AA Change: R1332H

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000127693
Gene: ENSMUSG00000002020
AA Change: R1332H

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
low complexity region 99 108 N/A INTRINSIC
EGF 184 213 6.55e-1 SMART
low complexity region 255 275 N/A INTRINSIC
EGF 384 413 8.19e-2 SMART
low complexity region 515 526 N/A INTRINSIC
Pfam:TB 545 582 4e-8 PFAM
EGF_CA 606 646 8.05e-10 SMART
Pfam:TB 665 707 3.8e-16 PFAM
EGF_CA 832 874 7.18e-7 SMART
EGF_CA 875 914 1.53e-10 SMART
EGF_CA 915 954 3.51e-10 SMART
EGF_CA 955 995 8.3e-12 SMART
EGF_CA 996 1037 4.56e-9 SMART
EGF_CA 1038 1079 4.56e-9 SMART
EGF_CA 1080 1120 8.76e-11 SMART
EGF_CA 1121 1162 4.38e-11 SMART
EGF_CA 1163 1203 1.75e-10 SMART
EGF_CA 1204 1247 2.24e-8 SMART
EGF_CA 1248 1289 6.01e-9 SMART
EGF 1293 1332 1.95e1 SMART
Pfam:TB 1367 1407 1.5e-11 PFAM
EGF_CA 1430 1472 2.31e-10 SMART
EGF_CA 1473 1512 7.93e-9 SMART
Pfam:TB 1538 1580 4.7e-13 PFAM
low complexity region 1648 1661 N/A INTRINSIC
EGF 1681 1718 4e-5 SMART
EGF_CA 1719 1763 1.91e-11 SMART
Predicted Effect unknown
Transcript: ENSMUST00000163214
AA Change: R174H
SMART Domains Protein: ENSMUSP00000132067
Gene: ENSMUSG00000002020
AA Change: R174H

DomainStartEndE-ValueType
EGF_CA 6 46 8.76e-11 SMART
EGF_CA 47 90 2.24e-8 SMART
EGF_CA 91 132 6.01e-9 SMART
EGF 136 175 1.95e1 SMART
Pfam:TB 210 250 1.5e-14 PFAM
EGF 276 307 1.5e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165141
SMART Domains Protein: ENSMUSP00000132690
Gene: ENSMUSG00000002020

DomainStartEndE-ValueType
EGF 1 31 1.2e1 SMART
EGF_CA 32 71 3.51e-10 SMART
EGF_CA 72 112 8.3e-12 SMART
EGF_CA 113 154 4.56e-9 SMART
EGF_like 155 183 1.67e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166383
SMART Domains Protein: ENSMUSP00000127255
Gene: ENSMUSG00000002020

DomainStartEndE-ValueType
EGF_CA 8 49 2.13e-9 SMART
Pfam:TB 75 117 1.3e-14 PFAM
low complexity region 185 198 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of latent transforming growth factor (TGF)-beta binding proteins (LTBP), which are extracellular matrix proteins with multi-domain structure. This protein is the largest member of the LTBP family possessing unique regions and with most similarity to the fibrillins. It has thus been suggested that it may have multiple functions: as a member of the TGF-beta latent complex, as a structural component of microfibrils, and a role in cell adhesion. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit early embryonic lethality prior to E6.5. Mice homozygous for a different null allele are viable, fertile, and developmentally normal but develop lens dislocations due to ciliary zonule fragmentation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace G A 11: 105,972,880 V385I probably benign Het
Apmap T C 2: 150,585,857 Y315C probably damaging Het
Arhgef12 G A 9: 43,005,608 T414I probably damaging Het
Cd200r1 C A 16: 44,766,034 A9D possibly damaging Het
Cdkal1 T C 13: 29,691,686 D183G probably benign Het
Clk1 C A 1: 58,412,660 C432F probably damaging Het
Col27a1 G T 4: 63,225,528 L484F probably damaging Het
Col7a1 A G 9: 108,978,143 E2480G unknown Het
D430042O09Rik A T 7: 125,867,655 M1361L possibly damaging Het
Dnah5 A G 15: 28,290,195 I1244V probably benign Het
Dock3 G T 9: 106,895,488 P522Q possibly damaging Het
Drc1 T A 5: 30,366,513 probably null Het
Epas1 C T 17: 86,823,686 T298I possibly damaging Het
Epha1 A T 6: 42,361,646 I699N probably damaging Het
Ephb3 T C 16: 21,221,687 S558P probably damaging Het
Epn1 T A 7: 5,097,166 L426* probably null Het
Fam234b T C 6: 135,225,267 V329A probably benign Het
Fasn G T 11: 120,816,124 R901S probably damaging Het
Fbln2 T C 6: 91,271,848 M1165T possibly damaging Het
Fer1l4 T C 2: 156,051,993 R103G probably benign Het
G6pd2 T A 5: 61,809,225 D114E probably benign Het
Galnt10 A G 11: 57,781,056 K391E probably damaging Het
Gpr150 C A 13: 76,055,926 C300F probably benign Het
Hhipl2 A G 1: 183,423,571 T151A probably damaging Het
Hmcn2 C A 2: 31,457,807 L4822M probably damaging Het
Ifi207 T A 1: 173,732,387 Q173L unknown Het
Inca1 T C 11: 70,689,881 E86G probably damaging Het
Iqca A G 1: 90,144,945 L71P probably benign Het
Kank2 G T 9: 21,795,393 Q110K probably damaging Het
Kif13b A T 14: 64,737,555 M407L probably damaging Het
Kif5a A C 10: 127,245,441 I208S probably damaging Het
Kmt2c T C 5: 25,284,471 K4490R probably damaging Het
Macf1 T C 4: 123,452,154 Q2061R possibly damaging Het
Marcks A G 10: 37,136,167 S291P probably benign Het
Mccc1 A G 3: 35,985,082 V254A possibly damaging Het
Mdn1 C T 4: 32,754,547 R4683W probably damaging Het
Mon2 A G 10: 123,010,492 probably null Het
Ndrg4 A T 8: 95,706,793 H134L probably damaging Het
Nek7 C A 1: 138,534,363 probably null Het
Nlrc3 C T 16: 3,953,995 S151N probably damaging Het
Nsl1 C A 1: 191,070,113 A146E probably benign Het
Olfr1391 A C 11: 49,327,933 N174T probably damaging Het
Olfr1477 T A 19: 13,502,558 Y72N probably damaging Het
Olfr519 A T 7: 108,894,085 F107L probably benign Het
Olfr655 A G 7: 104,596,897 Y95H probably benign Het
Olfr800 A T 10: 129,660,038 R77S probably benign Het
Pde4d A C 13: 109,740,442 S41R probably damaging Het
Phlpp1 T A 1: 106,347,132 L875* probably null Het
Pkd1 T A 17: 24,580,212 S2802T possibly damaging Het
Polr3b A G 10: 84,674,590 T500A probably benign Het
Ppp2r2c T C 5: 36,940,187 V239A probably benign Het
Pramef6 A G 4: 143,896,920 V228A probably benign Het
Reln T A 5: 21,899,113 I3287F probably damaging Het
Scube2 T C 7: 109,808,444 D763G probably damaging Het
Setd5 T C 6: 113,119,435 V534A probably benign Het
Slc10a4 T A 5: 73,012,030 C333S probably benign Het
Slc15a1 G A 14: 121,484,871 A206V probably damaging Het
Snx14 A G 9: 88,391,776 L654P probably damaging Het
Sowahc G A 10: 59,223,190 A383T possibly damaging Het
Taf1b A G 12: 24,500,449 D11G possibly damaging Het
Tap1 C T 17: 34,193,305 Q164* probably null Het
Tbcel T A 9: 42,415,872 R430W probably damaging Het
Trappc11 A T 8: 47,512,559 probably null Het
Trim15 T C 17: 36,862,840 I259V probably damaging Het
Trpt1 T C 19: 6,998,300 S141P probably damaging Het
Tsc2 T A 17: 24,613,216 Q732L probably benign Het
Tstd3 C A 4: 21,759,622 probably null Het
Unc13d T C 11: 116,064,625 K914R possibly damaging Het
Unk A G 11: 116,049,331 E170G probably damaging Het
Uqcc2 T A 17: 27,125,886 K62* probably null Het
Vim A G 2: 13,580,190 D394G probably damaging Het
Wdr47 G A 3: 108,624,736 probably null Het
Other mutations in Ltbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Ltbp2 APN 12 84791064 missense probably damaging 1.00
IGL00938:Ltbp2 APN 12 84831799 missense probably benign 0.03
IGL01397:Ltbp2 APN 12 84790268 missense probably damaging 1.00
IGL01570:Ltbp2 APN 12 84794033 missense probably benign 0.05
IGL01631:Ltbp2 APN 12 84809146 critical splice donor site probably null
IGL01662:Ltbp2 APN 12 84809246 missense probably benign 0.00
IGL01728:Ltbp2 APN 12 84791009 missense probably damaging 0.99
IGL01839:Ltbp2 APN 12 84793658 missense possibly damaging 0.48
IGL01946:Ltbp2 APN 12 84830748 missense probably damaging 1.00
IGL01977:Ltbp2 APN 12 84830199 missense probably damaging 1.00
IGL02220:Ltbp2 APN 12 84829309 missense possibly damaging 0.93
IGL02340:Ltbp2 APN 12 84792955 critical splice donor site probably null
IGL02430:Ltbp2 APN 12 84799401 missense probably damaging 1.00
IGL02492:Ltbp2 APN 12 84809665 missense probably damaging 1.00
IGL02517:Ltbp2 APN 12 84785317 missense probably benign 0.42
IGL02794:Ltbp2 APN 12 84791935 missense probably damaging 1.00
deft UTSW 12 84853912 missense probably damaging 0.98
R0045:Ltbp2 UTSW 12 84809587 missense probably damaging 1.00
R0045:Ltbp2 UTSW 12 84813288 missense probably damaging 1.00
R0091:Ltbp2 UTSW 12 84793733 missense probably damaging 1.00
R0094:Ltbp2 UTSW 12 84799426 missense probably damaging 1.00
R0166:Ltbp2 UTSW 12 84786358 missense probably benign 0.28
R0265:Ltbp2 UTSW 12 84785969 splice site probably null
R0394:Ltbp2 UTSW 12 84806424 splice site probably benign
R0535:Ltbp2 UTSW 12 84784858 missense probably damaging 1.00
R0535:Ltbp2 UTSW 12 84791052 missense probably damaging 1.00
R1465:Ltbp2 UTSW 12 84813300 missense probably damaging 1.00
R1465:Ltbp2 UTSW 12 84813300 missense probably damaging 1.00
R1513:Ltbp2 UTSW 12 84791944 missense probably damaging 1.00
R1858:Ltbp2 UTSW 12 84830781 nonsense probably null
R1880:Ltbp2 UTSW 12 84829271 missense probably benign 0.45
R1894:Ltbp2 UTSW 12 84787961 missense probably damaging 1.00
R1900:Ltbp2 UTSW 12 84830658 missense probably damaging 1.00
R1903:Ltbp2 UTSW 12 84830105 missense probably benign 0.01
R1912:Ltbp2 UTSW 12 84785863 missense probably damaging 0.98
R1993:Ltbp2 UTSW 12 84808446 critical splice acceptor site probably null
R1995:Ltbp2 UTSW 12 84808446 critical splice acceptor site probably null
R2069:Ltbp2 UTSW 12 84793733 missense probably damaging 1.00
R2126:Ltbp2 UTSW 12 84785709 unclassified probably null
R2139:Ltbp2 UTSW 12 84815979 missense probably damaging 1.00
R2341:Ltbp2 UTSW 12 84809163 missense probably benign 0.08
R2511:Ltbp2 UTSW 12 84804409 synonymous probably null
R3737:Ltbp2 UTSW 12 84804474 missense probably damaging 1.00
R3738:Ltbp2 UTSW 12 84804474 missense probably damaging 1.00
R3739:Ltbp2 UTSW 12 84804474 missense probably damaging 1.00
R3889:Ltbp2 UTSW 12 84784907 unclassified probably benign
R4034:Ltbp2 UTSW 12 84804474 missense probably damaging 1.00
R4542:Ltbp2 UTSW 12 84831819 nonsense probably null
R4621:Ltbp2 UTSW 12 84809348 missense probably damaging 1.00
R4623:Ltbp2 UTSW 12 84809348 missense probably damaging 1.00
R4831:Ltbp2 UTSW 12 84793640 missense possibly damaging 0.55
R5080:Ltbp2 UTSW 12 84803864 missense probably damaging 1.00
R5116:Ltbp2 UTSW 12 84809737 missense probably damaging 1.00
R5351:Ltbp2 UTSW 12 84790358 missense possibly damaging 0.95
R5445:Ltbp2 UTSW 12 84809654 missense probably null 1.00
R5608:Ltbp2 UTSW 12 84787464 intron probably null
R5784:Ltbp2 UTSW 12 84868739 missense probably damaging 1.00
R5859:Ltbp2 UTSW 12 84794063 missense possibly damaging 0.52
R6004:Ltbp2 UTSW 12 84876149 missense probably benign 0.00
R6028:Ltbp2 UTSW 12 84784852 missense probably damaging 1.00
R6347:Ltbp2 UTSW 12 84853912 missense probably damaging 0.98
R6615:Ltbp2 UTSW 12 84813317 missense probably damaging 1.00
R6636:Ltbp2 UTSW 12 84875838 missense probably benign 0.00
R6637:Ltbp2 UTSW 12 84875838 missense probably benign 0.00
R6755:Ltbp2 UTSW 12 84795073 missense probably damaging 1.00
R6759:Ltbp2 UTSW 12 84787410 missense probably damaging 0.99
R6806:Ltbp2 UTSW 12 84809238 missense possibly damaging 0.74
R6968:Ltbp2 UTSW 12 84789083 critical splice donor site probably null
R7084:Ltbp2 UTSW 12 84868685 missense probably damaging 1.00
R7250:Ltbp2 UTSW 12 84787392 nonsense probably null
R7374:Ltbp2 UTSW 12 84830175 missense probably damaging 1.00
R7501:Ltbp2 UTSW 12 84830645 missense probably damaging 1.00
R7523:Ltbp2 UTSW 12 84791034 missense probably benign 0.00
X0017:Ltbp2 UTSW 12 84828528 missense probably damaging 1.00
X0026:Ltbp2 UTSW 12 84830199 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACAGAGCACCCTGAGTTTC -3'
(R):5'- AGGGTGTACTTGCTTCCTCC -3'

Sequencing Primer
(F):5'- CACGTGCTGGCAAATGTG -3'
(R):5'- CTCTCTGTCCTCATGCCTGG -3'
Posted On2016-12-20