Mutagenetix > Incidental Mutations

Incidental Mutation 'R5838:Slc15a1'

449758

Institutional Source

Beutler Lab

Gene Symbol

Slc15a1

Ensembl Gene

ENSMUSG00000025557

Gene Name

solute carrier family 15 (oligopeptide transporter), member 1

Synonyms

PECT1, PEPT1

MMRRC Submission

044058-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.057) question?

Stock #

R5838 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

121459621-121505252 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 121484871 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 206 (A206V)

Ref Sequence

ENSEMBL: ENSMUSP00000085728 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000088386]

AlphaFold

Q9JIP7

Predicted Effect

probably damaging
Transcript: ENSMUST00000088386
AA Change: A206V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000085728
Gene: ENSMUSG00000025557
AA Change: A206V

Domain	Start	End	E-Value	Type
Pfam:PTR2	81	477	1.9e-141	PFAM
Pfam:PTR2	562	644	4.2e-11	PFAM
transmembrane domain	650	672	N/A	INTRINSIC
low complexity region	684	695	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227372

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intestinal hydrogen peptide cotransporter that is a member of the solute carrier family 15. The encoded protein is localized to the brush border membrane of the intestinal epithelium and mediates the uptake of di- and tripeptides from the lumen into the enterocytes. This protein plays an important role in the uptake and digestion of dietary proteins. This protein also facilitates the absorption of numerous peptidomimetic drugs. [provided by RefSeq, Apr 2010]
PHENOTYPE: Peptide uptake in the intestine is substantially reduced in mice homozygous for a null mutation of this gene. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ace	G	A	11: 105,972,880	V385I	probably benign	Het
Apmap	T	C	2: 150,585,857	Y315C	probably damaging	Het
Arhgef12	G	A	9: 43,005,608	T414I	probably damaging	Het
Cd200r1	C	A	16: 44,766,034	A9D	possibly damaging	Het
Cdkal1	T	C	13: 29,691,686	D183G	probably benign	Het
Clk1	C	A	1: 58,412,660	C432F	probably damaging	Het
Col27a1	G	T	4: 63,225,528	L484F	probably damaging	Het
Col7a1	A	G	9: 108,978,143	E2480G	unknown	Het
D430042O09Rik	A	T	7: 125,867,655	M1361L	possibly damaging	Het
Dnah5	A	G	15: 28,290,195	I1244V	probably benign	Het
Dock3	G	T	9: 106,895,488	P522Q	possibly damaging	Het
Drc1	T	A	5: 30,366,513		probably null	Het
Epas1	C	T	17: 86,823,686	T298I	possibly damaging	Het
Epha1	A	T	6: 42,361,646	I699N	probably damaging	Het
Ephb3	T	C	16: 21,221,687	S558P	probably damaging	Het
Epn1	T	A	7: 5,097,166	L426*	probably null	Het
Fam234b	T	C	6: 135,225,267	V329A	probably benign	Het
Fasn	G	T	11: 120,816,124	R901S	probably damaging	Het
Fbln2	T	C	6: 91,271,848	M1165T	possibly damaging	Het
Fer1l4	T	C	2: 156,051,993	R103G	probably benign	Het
G6pd2	T	A	5: 61,809,225	D114E	probably benign	Het
Galnt10	A	G	11: 57,781,056	K391E	probably damaging	Het
Gpr150	C	A	13: 76,055,926	C300F	probably benign	Het
Hhipl2	A	G	1: 183,423,571	T151A	probably damaging	Het
Hmcn2	C	A	2: 31,457,807	L4822M	probably damaging	Het
Ifi207	T	A	1: 173,732,387	Q173L	unknown	Het
Inca1	T	C	11: 70,689,881	E86G	probably damaging	Het
Iqca	A	G	1: 90,144,945	L71P	probably benign	Het
Kank2	G	T	9: 21,795,393	Q110K	probably damaging	Het
Kif13b	A	T	14: 64,737,555	M407L	probably damaging	Het
Kif5a	A	C	10: 127,245,441	I208S	probably damaging	Het
Kmt2c	T	C	5: 25,284,471	K4490R	probably damaging	Het
Ltbp2	C	T	12: 84,789,101	R1352H	probably benign	Het
Macf1	T	C	4: 123,452,154	Q2061R	possibly damaging	Het
Marcks	A	G	10: 37,136,167	S291P	probably benign	Het
Mccc1	A	G	3: 35,985,082	V254A	possibly damaging	Het
Mdn1	C	T	4: 32,754,547	R4683W	probably damaging	Het
Mon2	A	G	10: 123,010,492		probably null	Het
Ndrg4	A	T	8: 95,706,793	H134L	probably damaging	Het
Nek7	C	A	1: 138,534,363		probably null	Het
Nlrc3	C	T	16: 3,953,995	S151N	probably damaging	Het
Nsl1	C	A	1: 191,070,113	A146E	probably benign	Het
Olfr1391	A	C	11: 49,327,933	N174T	probably damaging	Het
Olfr1477	T	A	19: 13,502,558	Y72N	probably damaging	Het
Olfr519	A	T	7: 108,894,085	F107L	probably benign	Het
Olfr655	A	G	7: 104,596,897	Y95H	probably benign	Het
Olfr800	A	T	10: 129,660,038	R77S	probably benign	Het
Pde4d	A	C	13: 109,740,442	S41R	probably damaging	Het
Phlpp1	T	A	1: 106,347,132	L875*	probably null	Het
Pkd1	T	A	17: 24,580,212	S2802T	possibly damaging	Het
Polr3b	A	G	10: 84,674,590	T500A	probably benign	Het
Ppp2r2c	T	C	5: 36,940,187	V239A	probably benign	Het
Pramef6	A	G	4: 143,896,920	V228A	probably benign	Het
Reln	T	A	5: 21,899,113	I3287F	probably damaging	Het
Scube2	T	C	7: 109,808,444	D763G	probably damaging	Het
Setd5	T	C	6: 113,119,435	V534A	probably benign	Het
Slc10a4	T	A	5: 73,012,030	C333S	probably benign	Het
Snx14	A	G	9: 88,391,776	L654P	probably damaging	Het
Sowahc	G	A	10: 59,223,190	A383T	possibly damaging	Het
Taf1b	A	G	12: 24,500,449	D11G	possibly damaging	Het
Tap1	C	T	17: 34,193,305	Q164*	probably null	Het
Tbcel	T	A	9: 42,415,872	R430W	probably damaging	Het
Trappc11	A	T	8: 47,512,559		probably null	Het
Trim15	T	C	17: 36,862,840	I259V	probably damaging	Het
Trpt1	T	C	19: 6,998,300	S141P	probably damaging	Het
Tsc2	T	A	17: 24,613,216	Q732L	probably benign	Het
Tstd3	C	A	4: 21,759,622		probably null	Het
Unc13d	T	C	11: 116,064,625	K914R	possibly damaging	Het
Unk	A	G	11: 116,049,331	E170G	probably damaging	Het
Uqcc2	T	A	17: 27,125,886	K62*	probably null	Het
Vim	A	G	2: 13,580,190	D394G	probably damaging	Het
Wdr47	G	A	3: 108,624,736		probably null	Het

Other mutations in Slc15a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01337:Slc15a1	APN	14	121460679	missense	possibly damaging	0.95
IGL01534:Slc15a1	APN	14	121464952	missense	possibly damaging	0.95
IGL01783:Slc15a1	APN	14	121471276	critical splice donor site	probably null
IGL01799:Slc15a1	APN	14	121480729	missense	possibly damaging	0.76
IGL02064:Slc15a1	APN	14	121462499	missense	possibly damaging	0.66
IGL02064:Slc15a1	APN	14	121462474	missense	probably benign	0.20
IGL02115:Slc15a1	APN	14	121480661	missense	possibly damaging	0.61
IGL02514:Slc15a1	APN	14	121487040	missense	probably damaging	1.00
IGL03056:Slc15a1	APN	14	121491283	missense	possibly damaging	0.82
IGL03297:Slc15a1	APN	14	121486684	missense	probably damaging	1.00
R1484:Slc15a1	UTSW	14	121491239	nonsense	probably null
R1532:Slc15a1	UTSW	14	121475984	missense	possibly damaging	0.79
R1655:Slc15a1	UTSW	14	121465899	missense	probably benign	0.34
R2013:Slc15a1	UTSW	14	121475987	missense	possibly damaging	0.88
R2270:Slc15a1	UTSW	14	121479994	missense	probably damaging	0.99
R2878:Slc15a1	UTSW	14	121465933	missense	probably benign	0.00
R2986:Slc15a1	UTSW	14	121489809	missense	probably benign	0.02
R3862:Slc15a1	UTSW	14	121484857	missense	probably benign	0.06
R3863:Slc15a1	UTSW	14	121484857	missense	probably benign	0.06
R3978:Slc15a1	UTSW	14	121489827	missense	probably benign	0.00
R4184:Slc15a1	UTSW	14	121466162	missense	probably benign	0.00
R4573:Slc15a1	UTSW	14	121487029	missense	probably damaging	0.99
R4604:Slc15a1	UTSW	14	121489907	missense	probably damaging	1.00
R4649:Slc15a1	UTSW	14	121478092	missense	probably damaging	1.00
R6221:Slc15a1	UTSW	14	121464904	missense	probably null	1.00
R6891:Slc15a1	UTSW	14	121476030	missense	probably benign	0.00
R7626:Slc15a1	UTSW	14	121475965	missense	probably benign	0.13
R7836:Slc15a1	UTSW	14	121480733	nonsense	probably null
R8284:Slc15a1	UTSW	14	121489863	missense	probably benign	0.01
R8376:Slc15a1	UTSW	14	121480703	missense	probably benign
R8408:Slc15a1	UTSW	14	121478116	missense	possibly damaging	0.91
R8774:Slc15a1	UTSW	14	121487011	missense	probably damaging	1.00
R8774-TAIL:Slc15a1	UTSW	14	121487011	missense	probably damaging	1.00
R8933:Slc15a1	UTSW	14	121486679	missense	probably benign	0.00
R9157:Slc15a1	UTSW	14	121464977	missense	probably benign	0.08
Z1088:Slc15a1	UTSW	14	121480054	missense	probably benign	0.09
Z1088:Slc15a1	UTSW	14	121491044	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GATGCCTCTCCTTCAAAGCAC -3'
(R):5'- TTGGCCATGGCATCAGTGAC -3'

Sequencing Primer
(F):5'- AAAGCACTTTGAGATCTCATTTCCC -3'
(R):5'- GGCATCAGTGACATTAAGACATC -3'

Posted On

2016-12-20