Incidental Mutation 'R5848:Sel1l3'
ID453711
Institutional Source Beutler Lab
Gene Symbol Sel1l3
Ensembl Gene ENSMUSG00000029189
Gene Namesel-1 suppressor of lin-12-like 3 (C. elegans)
Synonyms2310045A20Rik
MMRRC Submission 043225-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5848 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location53107083-53213927 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 53184808 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Valine at position 357 (L357V)
Ref Sequence ENSEMBL: ENSMUSP00000031090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031090]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031090
AA Change: L357V

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000031090
Gene: ENSMUSG00000029189
AA Change: L357V

DomainStartEndE-ValueType
low complexity region 11 33 N/A INTRINSIC
SEL1 575 609 3.39e1 SMART
SEL1 611 647 1.85e1 SMART
SEL1 694 730 5.27e-5 SMART
SEL1 732 767 2.94e-3 SMART
SEL1 768 800 5.32e-1 SMART
SEL1 801 839 1.23e-5 SMART
SEL1 840 877 8.55e1 SMART
SEL1 952 988 2.56e-3 SMART
low complexity region 1048 1058 N/A INTRINSIC
transmembrane domain 1065 1087 N/A INTRINSIC
low complexity region 1102 1127 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196435
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700042G07Rik T C 4: 116,173,615 I72T probably damaging Het
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Aadacl4 T A 4: 144,617,858 M68K probably benign Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Armc4 T A 18: 7,268,507 probably null Het
Cdcp1 T A 9: 123,183,705 H259L possibly damaging Het
Ckap4 T C 10: 84,533,490 Q126R probably benign Het
Clec18a C T 8: 111,075,461 V299I probably benign Het
D7Ertd443e A G 7: 134,349,722 I27T possibly damaging Het
Dlg2 T G 7: 92,444,527 D726E probably benign Het
Dnah8 T C 17: 30,728,191 I1856T possibly damaging Het
Espl1 G A 15: 102,322,576 V1837I probably benign Het
Fanca G T 8: 123,295,053 probably benign Het
Fer1l5 A G 1: 36,388,935 T437A probably benign Het
Gm10644 C A 8: 83,934,039 probably benign Het
Katnb1 A G 8: 95,098,712 S635G probably benign Het
Map3k12 A G 15: 102,504,235 V234A possibly damaging Het
Mks1 A G 11: 87,856,870 N193S probably benign Het
Mmp11 T C 10: 75,927,389 E151G probably damaging Het
Napg A G 18: 62,994,369 R265G possibly damaging Het
Olfr49 A G 14: 54,282,565 F110S possibly damaging Het
Olfr513 T A 7: 108,755,574 C239* probably null Het
Pcdha7 G T 18: 36,975,083 C387F probably damaging Het
Pcdhb3 G T 18: 37,301,647 R222L probably benign Het
Phf2 A G 13: 48,820,070 M373T unknown Het
Plekha7 T C 7: 116,140,399 T636A probably damaging Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Rnf6 G A 5: 146,211,149 P353L probably benign Het
Sh3rf3 T A 10: 58,984,153 M262K possibly damaging Het
Sorcs3 A T 19: 48,788,511 H994L probably damaging Het
Thsd7a A T 6: 12,503,923 C411S probably damaging Het
Ttn T C 2: 76,763,338 K20653E probably damaging Het
Ttn A G 2: 76,780,920 W15677R probably damaging Het
Ttn A C 2: 76,878,564 probably null Het
Ubr2 T C 17: 46,956,655 M1049V possibly damaging Het
Other mutations in Sel1l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Sel1l3 APN 5 53116333 missense probably damaging 0.96
IGL01585:Sel1l3 APN 5 53154236 missense probably damaging 0.99
IGL01717:Sel1l3 APN 5 53200168 missense probably damaging 0.99
IGL01771:Sel1l3 APN 5 53121841 missense probably damaging 0.99
IGL01926:Sel1l3 APN 5 53200143 missense probably benign 0.26
IGL01963:Sel1l3 APN 5 53200338 missense probably damaging 0.99
IGL02000:Sel1l3 APN 5 53145493 missense probably damaging 1.00
IGL02132:Sel1l3 APN 5 53170405 missense possibly damaging 0.89
IGL02198:Sel1l3 APN 5 53139799 splice site probably benign
IGL02930:Sel1l3 APN 5 53123217 missense possibly damaging 0.65
IGL03146:Sel1l3 APN 5 53154243 missense probably benign 0.00
IGL03175:Sel1l3 APN 5 53121857 missense probably damaging 1.00
R0083:Sel1l3 UTSW 5 53137902 missense possibly damaging 0.79
R0108:Sel1l3 UTSW 5 53137902 missense possibly damaging 0.79
R0108:Sel1l3 UTSW 5 53137902 missense possibly damaging 0.79
R0940:Sel1l3 UTSW 5 53144037 splice site probably benign
R1027:Sel1l3 UTSW 5 53145478 missense possibly damaging 0.68
R1117:Sel1l3 UTSW 5 53172607 missense probably benign 0.00
R1145:Sel1l3 UTSW 5 53131827 missense probably damaging 0.99
R1145:Sel1l3 UTSW 5 53131827 missense probably damaging 0.99
R1146:Sel1l3 UTSW 5 53117103 missense possibly damaging 0.79
R1146:Sel1l3 UTSW 5 53117103 missense possibly damaging 0.79
R1345:Sel1l3 UTSW 5 53200217 missense possibly damaging 0.86
R1370:Sel1l3 UTSW 5 53200217 missense possibly damaging 0.86
R1503:Sel1l3 UTSW 5 53137929 missense probably damaging 0.98
R1747:Sel1l3 UTSW 5 53145545 missense possibly damaging 0.91
R1764:Sel1l3 UTSW 5 53170447 nonsense probably null
R2872:Sel1l3 UTSW 5 53137883 nonsense probably null
R2872:Sel1l3 UTSW 5 53137883 nonsense probably null
R3434:Sel1l3 UTSW 5 53117090 missense probably benign 0.44
R4043:Sel1l3 UTSW 5 53188054 nonsense probably null
R4074:Sel1l3 UTSW 5 53154287 missense probably damaging 0.99
R4727:Sel1l3 UTSW 5 53144183 critical splice acceptor site probably null
R4788:Sel1l3 UTSW 5 53131833 missense probably benign 0.41
R4900:Sel1l3 UTSW 5 53131842 missense probably damaging 1.00
R5000:Sel1l3 UTSW 5 53200434 missense probably damaging 0.97
R5090:Sel1l3 UTSW 5 53200046 missense probably benign 0.03
R5330:Sel1l3 UTSW 5 53186009 missense possibly damaging 0.80
R5456:Sel1l3 UTSW 5 53200036 missense probably benign 0.13
R5544:Sel1l3 UTSW 5 53200302 missense probably damaging 0.98
R6132:Sel1l3 UTSW 5 53200189 missense possibly damaging 0.77
R6188:Sel1l3 UTSW 5 53155719 missense possibly damaging 0.70
R6622:Sel1l3 UTSW 5 53139860 missense probably damaging 0.98
R7015:Sel1l3 UTSW 5 53172574 missense probably benign 0.03
R7200:Sel1l3 UTSW 5 53144109 missense probably benign 0.22
R7271:Sel1l3 UTSW 5 53116362 missense probably damaging 0.98
R7378:Sel1l3 UTSW 5 53116409 missense probably benign 0.02
R7479:Sel1l3 UTSW 5 53117120 missense probably damaging 0.99
R7563:Sel1l3 UTSW 5 53185984 missense probably damaging 1.00
R7643:Sel1l3 UTSW 5 53123162 splice site probably null
R7741:Sel1l3 UTSW 5 53200251 missense probably damaging 1.00
R7743:Sel1l3 UTSW 5 53135885 missense probably benign 0.07
R7861:Sel1l3 UTSW 5 53144064 missense probably damaging 0.96
R7904:Sel1l3 UTSW 5 53139824 missense probably benign 0.24
R7944:Sel1l3 UTSW 5 53144064 missense probably damaging 0.96
R7987:Sel1l3 UTSW 5 53139824 missense probably benign 0.24
Z1088:Sel1l3 UTSW 5 53116196 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TACTCATTCACCGCAGAGC -3'
(R):5'- GGGAATGTGGTTTAGTCTCATAACTTC -3'

Sequencing Primer
(F):5'- GCAAGTGTGTAATTGTAAAGGGTGC -3'
(R):5'- CTTCTTAGGAAGGTTATTGAGAAAGG -3'
Posted On2017-02-10