Incidental Mutation 'R5090:Sel1l3'
ID387687
Institutional Source Beutler Lab
Gene Symbol Sel1l3
Ensembl Gene ENSMUSG00000029189
Gene Namesel-1 suppressor of lin-12-like 3 (C. elegans)
Synonyms2310045A20Rik
MMRRC Submission 042679-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5090 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location53107083-53213927 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 53200046 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 201 (H201Q)
Ref Sequence ENSEMBL: ENSMUSP00000031090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031090]
Predicted Effect probably benign
Transcript: ENSMUST00000031090
AA Change: H201Q

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000031090
Gene: ENSMUSG00000029189
AA Change: H201Q

DomainStartEndE-ValueType
low complexity region 11 33 N/A INTRINSIC
SEL1 575 609 3.39e1 SMART
SEL1 611 647 1.85e1 SMART
SEL1 694 730 5.27e-5 SMART
SEL1 732 767 2.94e-3 SMART
SEL1 768 800 5.32e-1 SMART
SEL1 801 839 1.23e-5 SMART
SEL1 840 877 8.55e1 SMART
SEL1 952 988 2.56e-3 SMART
low complexity region 1048 1058 N/A INTRINSIC
transmembrane domain 1065 1087 N/A INTRINSIC
low complexity region 1102 1127 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196435
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199919
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.2%
Validation Efficiency 99% (66/67)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,385,199 S1168G probably damaging Het
Acsf2 A T 11: 94,571,269 probably null Het
AI481877 T C 4: 59,111,108 T55A unknown Het
Ankk1 G T 9: 49,421,763 S140R probably damaging Het
Ash1l G T 3: 89,052,877 K2305N probably damaging Het
Asnsd1 C T 1: 53,352,404 probably benign Het
Atxn7l1 T C 12: 33,326,078 S51P probably damaging Het
Ccdc88c A G 12: 100,954,180 L394P probably damaging Het
Cd200r1 T A 16: 44,789,561 S48T possibly damaging Het
Cemip T C 7: 83,942,135 E1243G probably damaging Het
Cep192 T A 18: 67,860,546 H1977Q possibly damaging Het
Cep250 T C 2: 155,976,404 L833P probably damaging Het
Chd9 C A 8: 91,026,834 Y1818* probably null Het
Clca3a1 C A 3: 144,737,872 V706L probably benign Het
Cntln T C 4: 84,947,593 V162A probably damaging Het
Col5a1 G A 2: 28,018,602 W67* probably null Het
Cux1 T A 5: 136,313,200 N446I possibly damaging Het
Dlg1 G T 16: 31,838,084 G599W probably damaging Het
Dock7 C T 4: 98,991,411 V969I probably benign Het
Ephb3 T C 16: 21,214,487 C74R probably damaging Het
Fads6 T A 11: 115,296,654 T72S probably benign Het
Fra10ac1 C T 19: 38,214,425 R110Q probably damaging Het
Gdf3 T A 6: 122,609,754 L71F probably benign Het
Gm1966 T A 7: 106,600,902 noncoding transcript Het
Gm6685 A G 11: 28,339,253 Y188H probably benign Het
Gm6981 A C 9: 52,002,842 noncoding transcript Het
Gnpda1 T C 18: 38,332,093 T157A probably damaging Het
Grap2 A C 15: 80,638,482 N70H possibly damaging Het
Hdac5 G A 11: 102,197,713 R887C probably damaging Het
Hectd3 T A 4: 117,000,238 probably benign Het
Hmgcr T C 13: 96,650,590 K162E probably benign Het
Inpp5e A T 2: 26,399,371 probably null Het
Kifap3 A G 1: 163,856,076 D442G possibly damaging Het
Lama3 A G 18: 12,542,402 T1015A possibly damaging Het
Lcp2 T A 11: 34,089,725 Y508* probably null Het
Map1b G T 13: 99,430,026 Y2062* probably null Het
Mipep A G 14: 60,802,299 D259G possibly damaging Het
Mmp2 T C 8: 92,852,574 F97S probably damaging Het
Mrpl18 A C 17: 12,913,810 M144R probably damaging Het
Nek9 A G 12: 85,329,842 probably null Het
Nmral1 A T 16: 4,714,531 Y139N probably damaging Het
Notch4 T C 17: 34,580,920 C952R probably damaging Het
Nsf T C 11: 103,910,578 N204D probably benign Het
P2rx4 A T 5: 122,725,055 D197V probably damaging Het
Pak7 A T 2: 136,087,418 I615N probably damaging Het
Parp10 T C 15: 76,241,725 D421G probably damaging Het
Pcdha6 A T 18: 36,968,717 D321V probably benign Het
Pkhd1 T A 1: 20,200,757 I3191F probably damaging Het
Psmd4 T C 3: 95,035,248 N7S possibly damaging Het
Ptprq A G 10: 107,526,089 V2084A probably damaging Het
Rab3gap1 A G 1: 127,915,678 E263G probably benign Het
Rbm5 A G 9: 107,760,312 probably benign Het
Sacs T C 14: 61,205,253 F1583L probably damaging Het
Tdpoz3 T A 3: 93,826,563 W182R possibly damaging Het
Trim55 A G 3: 19,671,607 N313S probably benign Het
Usp17lb A T 7: 104,841,083 D212E probably benign Het
Xirp2 A G 2: 67,525,470 E3525G possibly damaging Het
Zfp236 T C 18: 82,618,881 T1379A probably benign Het
Zfp553 A T 7: 127,235,487 E71D probably damaging Het
Znrf1 T G 8: 111,538,403 F21V probably benign Het
Other mutations in Sel1l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Sel1l3 APN 5 53116333 missense probably damaging 0.96
IGL01585:Sel1l3 APN 5 53154236 missense probably damaging 0.99
IGL01717:Sel1l3 APN 5 53200168 missense probably damaging 0.99
IGL01771:Sel1l3 APN 5 53121841 missense probably damaging 0.99
IGL01926:Sel1l3 APN 5 53200143 missense probably benign 0.26
IGL01963:Sel1l3 APN 5 53200338 missense probably damaging 0.99
IGL02000:Sel1l3 APN 5 53145493 missense probably damaging 1.00
IGL02132:Sel1l3 APN 5 53170405 missense possibly damaging 0.89
IGL02198:Sel1l3 APN 5 53139799 splice site probably benign
IGL02930:Sel1l3 APN 5 53123217 missense possibly damaging 0.65
IGL03146:Sel1l3 APN 5 53154243 missense probably benign 0.00
IGL03175:Sel1l3 APN 5 53121857 missense probably damaging 1.00
R0083:Sel1l3 UTSW 5 53137902 missense possibly damaging 0.79
R0108:Sel1l3 UTSW 5 53137902 missense possibly damaging 0.79
R0108:Sel1l3 UTSW 5 53137902 missense possibly damaging 0.79
R0940:Sel1l3 UTSW 5 53144037 splice site probably benign
R1027:Sel1l3 UTSW 5 53145478 missense possibly damaging 0.68
R1117:Sel1l3 UTSW 5 53172607 missense probably benign 0.00
R1145:Sel1l3 UTSW 5 53131827 missense probably damaging 0.99
R1145:Sel1l3 UTSW 5 53131827 missense probably damaging 0.99
R1146:Sel1l3 UTSW 5 53117103 missense possibly damaging 0.79
R1146:Sel1l3 UTSW 5 53117103 missense possibly damaging 0.79
R1345:Sel1l3 UTSW 5 53200217 missense possibly damaging 0.86
R1370:Sel1l3 UTSW 5 53200217 missense possibly damaging 0.86
R1503:Sel1l3 UTSW 5 53137929 missense probably damaging 0.98
R1747:Sel1l3 UTSW 5 53145545 missense possibly damaging 0.91
R1764:Sel1l3 UTSW 5 53170447 nonsense probably null
R2872:Sel1l3 UTSW 5 53137883 nonsense probably null
R2872:Sel1l3 UTSW 5 53137883 nonsense probably null
R3434:Sel1l3 UTSW 5 53117090 missense probably benign 0.44
R4043:Sel1l3 UTSW 5 53188054 nonsense probably null
R4074:Sel1l3 UTSW 5 53154287 missense probably damaging 0.99
R4727:Sel1l3 UTSW 5 53144183 critical splice acceptor site probably null
R4788:Sel1l3 UTSW 5 53131833 missense probably benign 0.41
R4900:Sel1l3 UTSW 5 53131842 missense probably damaging 1.00
R5000:Sel1l3 UTSW 5 53200434 missense probably damaging 0.97
R5330:Sel1l3 UTSW 5 53186009 missense possibly damaging 0.80
R5456:Sel1l3 UTSW 5 53200036 missense probably benign 0.13
R5544:Sel1l3 UTSW 5 53200302 missense probably damaging 0.98
R5848:Sel1l3 UTSW 5 53184808 missense possibly damaging 0.91
R6132:Sel1l3 UTSW 5 53200189 missense possibly damaging 0.77
R6188:Sel1l3 UTSW 5 53155719 missense possibly damaging 0.70
R6622:Sel1l3 UTSW 5 53139860 missense probably damaging 0.98
R7015:Sel1l3 UTSW 5 53172574 missense probably benign 0.03
R7200:Sel1l3 UTSW 5 53144109 missense probably benign 0.22
R7271:Sel1l3 UTSW 5 53116362 missense probably damaging 0.98
R7378:Sel1l3 UTSW 5 53116409 missense probably benign 0.02
R7479:Sel1l3 UTSW 5 53117120 missense probably damaging 0.99
R7563:Sel1l3 UTSW 5 53185984 missense probably damaging 1.00
R7741:Sel1l3 UTSW 5 53200251 missense probably damaging 1.00
R7743:Sel1l3 UTSW 5 53135885 missense probably benign 0.07
R7861:Sel1l3 UTSW 5 53144064 missense probably damaging 0.96
R7904:Sel1l3 UTSW 5 53139824 missense probably benign 0.24
R7944:Sel1l3 UTSW 5 53144064 missense probably damaging 0.96
R7987:Sel1l3 UTSW 5 53139824 missense probably benign 0.24
Z1088:Sel1l3 UTSW 5 53116196 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTGCTGTTGTGCGATGACAC -3'
(R):5'- GGAATGAGAAGCATCTTCACAC -3'

Sequencing Primer
(F):5'- ACAAGAATGTGCTGTGCCAC -3'
(R):5'- TCTTCACACCAGCAGGACG -3'
Posted On2016-06-06