Incidental Mutation 'R5888:Slc25a27'
ID 457841
Institutional Source Beutler Lab
Gene Symbol Slc25a27
Ensembl Gene ENSMUSG00000023912
Gene Name solute carrier family 25, member 27
Synonyms D530043E16Rik, 3632410G24Rik, Ucp4, 9430092A03Rik
MMRRC Submission 044089-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock # R5888 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 43641900-43667015 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 43649694 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 211 (D211G)
Ref Sequence ENSEMBL: ENSMUSP00000024705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024705]
AlphaFold Q9D6D0
Predicted Effect probably damaging
Transcript: ENSMUST00000024705
AA Change: D211G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000024705
Gene: ENSMUSG00000023912
AA Change: D211G

DomainStartEndE-ValueType
Pfam:Mito_carr 15 119 1.4e-21 PFAM
Pfam:Mito_carr 122 221 2e-23 PFAM
Pfam:Mito_carr 224 319 1.1e-20 PFAM
Meta Mutation Damage Score 0.7721 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 94% (96/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitochondrial uncoupling proteins (UCP) are members of the larger family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. Transcripts of this gene are only detected in brain tissue and are specifically modulated by various environmental conditions. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029P11Rik T C 15: 81,980,671 S38P probably benign Het
Adcy1 T A 11: 7,139,095 V503E possibly damaging Het
Alk C A 17: 71,874,943 V1362L probably damaging Het
Ankrd55 T A 13: 112,355,919 I208N possibly damaging Het
Asap2 T A 12: 21,218,190 I319N probably damaging Het
Atp11b T C 3: 35,837,547 I1036T probably benign Het
B4gat1 T C 19: 5,039,532 F186L probably benign Het
C3 T A 17: 57,214,831 T1079S probably damaging Het
Cacul1 G T 19: 60,537,464 T287K possibly damaging Het
Cbr3 G C 16: 93,690,726 G266R probably damaging Het
Cd63 T A 10: 128,912,291 probably null Het
Chd7 G A 4: 8,866,382 M851I probably damaging Het
Chst13 T A 6: 90,309,572 H136L probably benign Het
Cyp2d22 T C 15: 82,373,813 T179A probably benign Het
Dclre1b A T 3: 103,803,737 V286E probably damaging Het
Defb45 G A 2: 152,593,234 probably benign Het
Dlg1 T C 16: 31,791,886 probably null Het
Dock3 A G 9: 107,023,803 V321A probably benign Het
Dytn A T 1: 63,677,237 V59E possibly damaging Het
Eif2ak1 A G 5: 143,886,915 I393M probably damaging Het
Fam83g A T 11: 61,702,594 E318V probably benign Het
Fbxo34 T A 14: 47,529,719 F179I probably damaging Het
Fmo5 T A 3: 97,641,725 Y230N probably benign Het
Fzd9 T G 5: 135,249,463 probably null Het
Gata2 T C 6: 88,200,740 S251P probably benign Het
Gigyf1 A G 5: 137,525,697 D1043G probably damaging Het
Gm10260 G A 13: 97,760,393 R66* probably null Het
Gm10322 T A 10: 59,616,303 S81T probably benign Het
Gm11639 T C 11: 104,721,401 probably benign Het
Gm15517 A T 7: 44,260,642 probably benign Het
Haus4 T C 14: 54,544,219 T232A probably benign Het
Hgfac A T 5: 35,045,407 H417L probably damaging Het
Iqgap2 T C 13: 95,635,610 K1354E possibly damaging Het
Kcnk12 C A 17: 87,746,649 R195L probably benign Het
Kcnn2 A T 18: 45,592,345 I303F probably damaging Het
Kcnt1 T C 2: 25,908,110 F879S probably damaging Het
Kndc1 T C 7: 139,895,217 F11L probably benign Het
Kpna7 A G 5: 144,989,795 F449S probably damaging Het
Krt77 G T 15: 101,865,453 N255K probably benign Het
Lair1 A T 7: 4,010,845 D134E probably damaging Het
Loxhd1 T C 18: 77,402,515 V1318A probably damaging Het
March10 A T 11: 105,402,146 V145D possibly damaging Het
Mcpt1 T A 14: 56,019,512 M169K probably benign Het
Mdc1 T A 17: 35,847,820 V364E probably benign Het
Mfsd11 T C 11: 116,871,384 F270S probably damaging Het
Mfsd4b2 T G 10: 39,922,035 D108A probably benign Het
Mink1 A T 11: 70,610,059 probably benign Het
Mmp25 T C 17: 23,631,074 Y504C probably damaging Het
Ms4a13 C T 19: 11,191,506 V52I probably benign Het
Msh4 C T 3: 153,867,723 probably null Het
Muc5b T G 7: 141,858,421 S1701R unknown Het
Naalad2 A T 9: 18,330,641 S656T probably benign Het
Ncapd2 T C 6: 125,187,089 Y64C probably damaging Het
Ncapg2 T A 12: 116,425,800 S347T possibly damaging Het
Nipal4 T C 11: 46,151,339 T172A probably damaging Het
Nrros T C 16: 32,143,087 K652R probably benign Het
Nrxn3 G T 12: 89,512,085 A983S possibly damaging Het
Olfr1084 A C 2: 86,639,144 L188R probably damaging Het
Olfr1187-ps1 T C 2: 88,540,244 noncoding transcript Het
Olfr1220 T A 2: 89,097,925 M1L probably damaging Het
Olfr1249 T A 2: 89,630,799 Y33F probably damaging Het
Olfr1283 T C 2: 111,368,743 M37T probably benign Het
Olfr631 A G 7: 103,929,032 T70A possibly damaging Het
Olfr938 A T 9: 39,077,967 Y259* probably null Het
P2rx4 T A 5: 122,719,165 S155T probably benign Het
P2rx4 T G 5: 122,727,208 Y299D probably damaging Het
Pcsk6 A T 7: 66,043,624 L7F probably null Het
Pdss2 T C 10: 43,221,797 silent Het
Pfkl A G 10: 77,991,370 V494A possibly damaging Het
Prep G T 10: 45,067,364 D12Y possibly damaging Het
Prg4 A G 1: 150,452,350 F188S probably damaging Het
Ripor3 T C 2: 167,997,287 Y98C probably damaging Het
Rnf216 T A 5: 143,068,314 probably null Het
Rnf24 A G 2: 131,322,245 probably benign Het
Scn3a A G 2: 65,497,398 M916T probably benign Het
Scnm1 T C 3: 95,130,285 I157V probably benign Het
Sh2b3 C G 5: 121,829,021 R10P possibly damaging Het
Slc36a4 A T 9: 15,727,028 Y250F probably damaging Het
Slc4a1 T A 11: 102,356,525 E448V probably damaging Het
Slit1 C A 19: 41,743,296 C38F probably damaging Het
Spock3 T A 8: 63,355,300 N410K unknown Het
Supt20 G T 3: 54,712,207 W370L probably benign Het
Tas2r139 T A 6: 42,141,496 N187K probably damaging Het
Tbc1d9b G A 11: 50,140,484 V111I probably benign Het
Thsd7b T A 1: 130,210,320 Y1578* probably null Het
Tln2 T A 9: 67,229,403 I1267F probably damaging Het
Tnk2 G A 16: 32,671,367 V363I probably damaging Het
Ttc32 A G 12: 9,035,870 K139R possibly damaging Het
Vmn1r30 G C 6: 58,435,565 T94S possibly damaging Het
Vmn1r90 G A 7: 14,561,855 T106I probably damaging Het
Zfp677 T A 17: 21,398,258 C526S probably damaging Het
Zfp831 T G 2: 174,643,627 S32A probably benign Het
Other mutations in Slc25a27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Slc25a27 APN 17 43664089 missense probably benign 0.01
IGL01767:Slc25a27 APN 17 43664073 critical splice donor site probably null
IGL02207:Slc25a27 APN 17 43661684 missense probably damaging 1.00
IGL02218:Slc25a27 APN 17 43664073 critical splice donor site probably null
IGL02795:Slc25a27 APN 17 43647112 missense probably damaging 1.00
R0243:Slc25a27 UTSW 17 43643627 missense probably benign 0.03
R1591:Slc25a27 UTSW 17 43653424 missense probably benign 0.12
R2165:Slc25a27 UTSW 17 43657772 missense probably benign 0.00
R2974:Slc25a27 UTSW 17 43653371 missense probably damaging 1.00
R5087:Slc25a27 UTSW 17 43666930 missense probably damaging 1.00
R6283:Slc25a27 UTSW 17 43657730 missense probably damaging 1.00
R7309:Slc25a27 UTSW 17 43664192 missense probably benign
R7920:Slc25a27 UTSW 17 43649673 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGACAAGGCCAGATATGTCC -3'
(R):5'- GCACAGCTCGATACAATGAGTTC -3'

Sequencing Primer
(F):5'- TCAAGGGGATCCAAGCTCTTC -3'
(R):5'- AGCTCGATACAATGAGTTCCTGTTTC -3'
Posted On 2017-02-15