Mutagenetix > Incidental Mutation

Incidental Mutation 'R0561:Ddx60'

45876

Institutional Source

Beutler Lab

Gene Symbol

Ddx60

Ensembl Gene

ENSMUSG00000037921

Gene Name

DEAD (Asp-Glu-Ala-Asp) box polypeptide 60

Synonyms

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.142) question?

Stock #

R0561 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

61928087-62038244 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 62017794 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 1440 (H1440L)

Ref Sequence

ENSEMBL: ENSMUSP00000091197 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070631] [ENSMUST00000093485]

AlphaFold

E9PZQ1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000070631
AA Change: H1439L

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000070741
Gene: ENSMUSG00000037921
AA Change: H1439L

Domain	Start	End	E-Value	Type
low complexity region	99	110	N/A	INTRINSIC
low complexity region	364	376	N/A	INTRINSIC
DEXDc	758	949	1.05e-15	SMART
Blast:DEXDc	1007	1132	4e-24	BLAST
HELICc	1245	1328	4.35e-13	SMART
low complexity region	1362	1373	N/A	INTRINSIC
Blast:DEXDc	1503	1584	1e-20	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000093485
AA Change: H1440L

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000091197
Gene: ENSMUSG00000037921
AA Change: H1440L

Domain	Start	End	E-Value	Type
low complexity region	99	110	N/A	INTRINSIC
low complexity region	364	376	N/A	INTRINSIC
DEXDc	759	950	1.05e-15	SMART
Blast:DEXDc	1008	1133	4e-24	BLAST
HELICc	1246	1329	4.35e-13	SMART
low complexity region	1363	1374	N/A	INTRINSIC
Blast:DEXDc	1504	1585	1e-20	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136121

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 96.9%
20x: 94.6%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal immunity to several viruses (IAV, EMCV, SINV) but increased susceptibility to VSV infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adck1	A	G	12: 88,368,434	D30G	possibly damaging	Het
Apc	A	T	18: 34,313,303	H1050L	possibly damaging	Het
Armc2	A	G	10: 41,993,192	V166A	probably benign	Het
Atp6v1b1	A	T	6: 83,753,811	I173F	probably damaging	Het
Bpifb4	A	G	2: 153,944,822	D298G	probably damaging	Het
C4b	T	A	17: 34,734,417	S1031C	probably damaging	Het
Calcr	A	G	6: 3,692,630	I408T	probably damaging	Het
Catsperg1	T	C	7: 29,182,312	N1009S	probably damaging	Het
Ces2a	T	C	8: 104,737,533	S266P	probably benign	Het
Chrna1	A	G	2: 73,566,252	V433A	possibly damaging	Het
Ctnnb1	G	A	9: 120,951,722	V291M	probably damaging	Het
Dcbld1	T	C	10: 52,261,936	Y99H	probably benign	Het
Dsg1c	A	T	18: 20,274,775	I393L	probably benign	Het
Eif5	G	T	12: 111,540,516	R128L	probably benign	Het
Ercc3	A	G	18: 32,245,539	D191G	possibly damaging	Het
Gp1ba	A	T	11: 70,639,590		probably benign	Het
Krt24	C	T	11: 99,284,613	E199K	probably damaging	Het
Lrif1	G	T	3: 106,732,165	A164S	probably damaging	Het
Map2	A	G	1: 66,425,497	D1682G	probably damaging	Het
Megf8	C	T	7: 25,328,832	P274S	probably benign	Het
Mslnl	C	T	17: 25,743,203	Q192*	probably null	Het
Nfkb2	T	C	19: 46,309,862	V535A	possibly damaging	Het
Olfr1196	A	G	2: 88,700,570	I253T	possibly damaging	Het
Olfr1206	T	A	2: 88,864,680	V25E	possibly damaging	Het
Olfr1353	T	A	10: 78,969,895	L82*	probably null	Het
Olfr1494	A	T	19: 13,749,298	Y64F	probably damaging	Het
Olfr884	G	T	9: 38,047,827	V202L	probably benign	Het
Olfr936	C	T	9: 39,047,373	M15I	probably damaging	Het
Pag1	T	A	3: 9,699,421	Y224F	probably damaging	Het
Pbrm1	A	C	14: 31,035,991	I193L	probably benign	Het
Phrf1	T	C	7: 141,254,963	V17A	probably benign	Het
Plekhg2	T	G	7: 28,370,483	T42P	probably benign	Het
Pmp22	T	A	11: 63,134,424	W28R	probably damaging	Het
Ppp1r13b	A	T	12: 111,866,446	H82Q	probably damaging	Het
Rgs8	T	C	1: 153,665,922		probably null	Het
Rtl1	A	G	12: 109,593,929	V492A	probably damaging	Het
Slc22a27	A	G	19: 7,880,162		probably null	Het
Slx4ip	A	G	2: 137,066,170	E79G	probably null	Het
Syde1	C	T	10: 78,589,376	R267H	probably damaging	Het
Tas2r114	A	G	6: 131,689,795	I90T	probably benign	Het
Tjp3	C	T	10: 81,273,840	G843D	probably benign	Het
Tln1	A	T	4: 43,550,304	M453K	possibly damaging	Het
Ttc39a	A	T	4: 109,440,602	Y408F	probably damaging	Het
Usp39	T	G	6: 72,336,385	Q274P	probably damaging	Het
Uvrag	C	T	7: 98,888,561	V476I	probably damaging	Het
Vcan	T	A	13: 89,712,253	T332S	probably damaging	Het
Vcan	T	A	13: 89,731,464	H22L	possibly damaging	Het
Wls	A	G	3: 159,873,068	D89G	probably benign	Het
Zfhx2	A	T	14: 55,065,889	V1546E	probably benign	Het
Zfp457	T	A	13: 67,294,070	H147L	probably damaging	Het

Other mutations in Ddx60

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Ddx60	APN	8	61958646	missense	probably damaging	1.00
IGL00915:Ddx60	APN	8	61987431	missense	possibly damaging	0.79
IGL00931:Ddx60	APN	8	61969583	missense	probably benign	0.18
IGL01023:Ddx60	APN	8	61942514	missense	probably damaging	0.99
IGL01313:Ddx60	APN	8	61982526	missense	probably damaging	1.00
IGL01615:Ddx60	APN	8	61963740	missense	probably null	0.81
IGL01733:Ddx60	APN	8	61983865	missense	probably damaging	0.99
IGL01779:Ddx60	APN	8	62017823	missense	possibly damaging	0.94
IGL01900:Ddx60	APN	8	62000709	splice site	probably benign
IGL02110:Ddx60	APN	8	62017247	critical splice donor site	probably null
IGL02302:Ddx60	APN	8	61975832	missense	possibly damaging	0.85
IGL02468:Ddx60	APN	8	61958642	missense	probably damaging	1.00
IGL02569:Ddx60	APN	8	62024951	missense	possibly damaging	0.93
IGL02622:Ddx60	APN	8	61942436	splice site	probably null
IGL02657:Ddx60	APN	8	61984115	missense	probably benign	0.01
IGL02677:Ddx60	APN	8	61988132	missense	probably damaging	1.00
IGL02701:Ddx60	APN	8	61979341	missense	probably damaging	0.96
IGL02806:Ddx60	APN	8	61956122	missense	probably benign	0.00
IGL03137:Ddx60	APN	8	61988083	missense	possibly damaging	0.61
IGL03295:Ddx60	APN	8	61956121	missense	possibly damaging	0.82
IGL03387:Ddx60	APN	8	62012449	missense	probably damaging	1.00
IGL03411:Ddx60	APN	8	61977882	critical splice acceptor site	probably null
Scatter	UTSW	8	62021314	missense	possibly damaging	0.80
shotgun	UTSW	8	62037067	missense	probably benign	0.28
splay	UTSW	8	62021309	missense	possibly damaging	0.80
G1Funyon:Ddx60	UTSW	8	62000597	missense	probably benign	0.01
PIT4504001:Ddx60	UTSW	8	61958113	missense	probably benign
PIT4677001:Ddx60	UTSW	8	61972254	missense	possibly damaging	0.87
R0090:Ddx60	UTSW	8	61942293	missense	probably damaging	1.00
R0266:Ddx60	UTSW	8	62033493	missense	possibly damaging	0.92
R0325:Ddx60	UTSW	8	61983855	missense	probably benign	0.00
R0367:Ddx60	UTSW	8	62017749	missense	possibly damaging	0.78
R0403:Ddx60	UTSW	8	61994541	splice site	probably benign
R0479:Ddx60	UTSW	8	61969657	missense	probably damaging	1.00
R0844:Ddx60	UTSW	8	61987361	missense	probably benign	0.27
R1119:Ddx60	UTSW	8	61942544	missense	probably damaging	1.00
R1428:Ddx60	UTSW	8	61958159	splice site	probably benign
R1778:Ddx60	UTSW	8	61974176	missense	possibly damaging	0.85
R1840:Ddx60	UTSW	8	61969553	missense	probably damaging	0.99
R1964:Ddx60	UTSW	8	61948869	missense	probably benign	0.10
R1970:Ddx60	UTSW	8	61972206	missense	possibly damaging	0.93
R2101:Ddx60	UTSW	8	61940645	missense	probably damaging	1.00
R2174:Ddx60	UTSW	8	61956141	missense	probably damaging	1.00
R2174:Ddx60	UTSW	8	62017200	missense	probably benign	0.01
R2198:Ddx60	UTSW	8	61958063	missense	possibly damaging	0.79
R2332:Ddx60	UTSW	8	62037091	missense	probably benign	0.08
R2338:Ddx60	UTSW	8	62012436	missense	possibly damaging	0.91
R2379:Ddx60	UTSW	8	62037088	missense	probably damaging	1.00
R4010:Ddx60	UTSW	8	61954535	missense	possibly damaging	0.65
R4010:Ddx60	UTSW	8	61956144	missense	probably benign	0.25
R4133:Ddx60	UTSW	8	61972220	missense	probably damaging	0.99
R4282:Ddx60	UTSW	8	61994393	missense	probably damaging	0.99
R4382:Ddx60	UTSW	8	61948978	splice site	probably null
R4561:Ddx60	UTSW	8	61942461	missense	probably damaging	0.96
R4572:Ddx60	UTSW	8	61987421	missense	probably damaging	1.00
R4581:Ddx60	UTSW	8	62023261	missense	possibly damaging	0.90
R4635:Ddx60	UTSW	8	62037067	missense	probably benign	0.28
R4698:Ddx60	UTSW	8	62012424	missense	probably benign	0.01
R4807:Ddx60	UTSW	8	61979338	missense	probably damaging	1.00
R4858:Ddx60	UTSW	8	62021314	missense	possibly damaging	0.80
R4964:Ddx60	UTSW	8	61979338	missense	probably damaging	1.00
R5120:Ddx60	UTSW	8	61945906	missense	probably benign	0.01
R5187:Ddx60	UTSW	8	61974188	missense	probably damaging	1.00
R5222:Ddx60	UTSW	8	61984158	missense	probably damaging	0.99
R5400:Ddx60	UTSW	8	62010002	missense	possibly damaging	0.65
R5500:Ddx60	UTSW	8	61950451	missense	probably benign	0.28
R5514:Ddx60	UTSW	8	61958057	missense	probably damaging	1.00
R5668:Ddx60	UTSW	8	62000578	missense	probably benign	0.38
R5742:Ddx60	UTSW	8	61948921	missense	probably benign
R5772:Ddx60	UTSW	8	61948897	missense	probably damaging	1.00
R5810:Ddx60	UTSW	8	62012388	nonsense	probably null
R5815:Ddx60	UTSW	8	61963722	missense	probably damaging	0.98
R5820:Ddx60	UTSW	8	61956121	missense	possibly damaging	0.82
R5866:Ddx60	UTSW	8	61940740	missense	probably damaging	1.00
R5881:Ddx60	UTSW	8	62037070	missense	probably damaging	1.00
R5977:Ddx60	UTSW	8	62021410	critical splice donor site	probably null
R6048:Ddx60	UTSW	8	62000582	missense	probably benign	0.01
R6061:Ddx60	UTSW	8	62023241	missense	probably null	0.01
R6153:Ddx60	UTSW	8	61945940	missense	possibly damaging	0.47
R6287:Ddx60	UTSW	8	61950578	missense	probably damaging	1.00
R6415:Ddx60	UTSW	8	61983905	missense	probably benign	0.00
R6416:Ddx60	UTSW	8	61977950	missense	probably benign	0.00
R6416:Ddx60	UTSW	8	61998681	missense	probably benign
R6660:Ddx60	UTSW	8	61956239	missense	probably benign	0.00
R6694:Ddx60	UTSW	8	62037070	missense	probably damaging	1.00
R6715:Ddx60	UTSW	8	61983890	missense	probably benign	0.03
R6720:Ddx60	UTSW	8	62000689	missense	probably benign	0.10
R6937:Ddx60	UTSW	8	62037069	missense	probably damaging	1.00
R7153:Ddx60	UTSW	8	61988108	missense	possibly damaging	0.71
R7274:Ddx60	UTSW	8	61940108	critical splice donor site	probably null
R7409:Ddx60	UTSW	8	61958578	missense	probably benign	0.24
R7464:Ddx60	UTSW	8	61940674	missense	possibly damaging	0.82
R7670:Ddx60	UTSW	8	61975792	missense	probably damaging	1.00
R7904:Ddx60	UTSW	8	61977890	missense	possibly damaging	0.81
R7992:Ddx60	UTSW	8	61954535	missense	probably benign	0.03
R8124:Ddx60	UTSW	8	61983911	missense	probably benign
R8125:Ddx60	UTSW	8	61983911	missense	probably benign
R8126:Ddx60	UTSW	8	61983911	missense	probably benign
R8155:Ddx60	UTSW	8	62017171	missense	possibly damaging	0.61
R8174:Ddx60	UTSW	8	62017250	splice site	probably null
R8192:Ddx60	UTSW	8	61977968	missense	probably damaging	1.00
R8271:Ddx60	UTSW	8	61940108	critical splice donor site	probably null
R8301:Ddx60	UTSW	8	62000597	missense	probably benign	0.01
R8304:Ddx60	UTSW	8	61998769	missense	possibly damaging	0.67
R8319:Ddx60	UTSW	8	61942635	critical splice donor site	probably null
R8374:Ddx60	UTSW	8	61974171	missense	probably benign	0.01
R8401:Ddx60	UTSW	8	61956243	missense	possibly damaging	0.57
R8487:Ddx60	UTSW	8	61974150	missense	probably damaging	1.00
R8804:Ddx60	UTSW	8	61958606	missense	probably benign	0.27
R8826:Ddx60	UTSW	8	61945956	missense	probably benign	0.02
R8829:Ddx60	UTSW	8	61940661	missense	probably damaging	1.00
R8881:Ddx60	UTSW	8	62021309	missense	possibly damaging	0.80
R8884:Ddx60	UTSW	8	61994519	missense	possibly damaging	0.86
R8990:Ddx60	UTSW	8	61974134	nonsense	probably null
R9122:Ddx60	UTSW	8	61989864	missense	probably benign	0.16
R9225:Ddx60	UTSW	8	62017841	missense	probably benign	0.36
R9278:Ddx60	UTSW	8	61977978	missense	possibly damaging	0.83
R9293:Ddx60	UTSW	8	62009960	missense	possibly damaging	0.89
R9405:Ddx60	UTSW	8	61972214	missense	probably benign	0.03
X0003:Ddx60	UTSW	8	62033417	missense	possibly damaging	0.88
X0019:Ddx60	UTSW	8	61963692	missense	probably benign	0.01
Z1177:Ddx60	UTSW	8	62000588	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- GAACCAACCCTGCCTTTCGTTCT -3'
(R):5'- TCCCAACATGGGAAGAtgtgtgtg -3'

Sequencing Primer
(F):5'- tgccgagccatctctcc -3'
(R):5'- GTGTGTGTGTGTGTAAAATACCT -3'

Posted On

2013-06-11