Incidental Mutation 'R6054:Wdr48'
ID484312
Institutional Source Beutler Lab
Gene Symbol Wdr48
Ensembl Gene ENSMUSG00000032512
Gene NameWD repeat domain 48
SynonymsUaf1, 8430408H12Rik
MMRRC Submission 044222-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6054 (G1)
Quality Score164.009
Status Not validated
Chromosome9
Chromosomal Location119894878-119926587 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119907777 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 22 (D22G)
Ref Sequence ENSEMBL: ENSMUSP00000149793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036561] [ENSMUST00000177637] [ENSMUST00000215167] [ENSMUST00000215307] [ENSMUST00000217472]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036561
AA Change: D221G

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000042509
Gene: ENSMUSG00000032512
AA Change: D221G

DomainStartEndE-ValueType
WD40 14 58 2.88e-1 SMART
WD40 64 103 2.1e-7 SMART
WD40 106 145 1.37e-6 SMART
WD40 157 196 5.39e-5 SMART
WD40 199 238 1.62e-8 SMART
WD40 241 280 4.62e-4 SMART
WD40 350 388 8.84e1 SMART
low complexity region 460 471 N/A INTRINSIC
Pfam:DUF3337 509 673 1.1e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177637
SMART Domains Protein: ENSMUSP00000136413
Gene: ENSMUSG00000052336

DomainStartEndE-ValueType
Pfam:7tm_1 49 294 3.5e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214716
Predicted Effect probably damaging
Transcript: ENSMUST00000215167
AA Change: D22G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215307
AA Change: D221G

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217472
AA Change: D221G

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has been shown to interact with ubiquitin specific peptidase 1 (USP1), activating the deubiquitinating activity of USP1 and allowing it to remove the ubiquitin moiety from monoubiquitinated FANCD2. FANCD2 is ubiquitinated in response to DNA damage. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality prior to E10.5 with reduced embryonic growth. Mice heterozygous for this allele exhibit reduced weight at birth, skeletal defects and reduced female and male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,835,865 S93P unknown Het
Adam28 T A 14: 68,642,152 N149I probably benign Het
Adam4 A C 12: 81,420,054 F598V probably damaging Het
Adh5 A G 3: 138,445,375 H33R possibly damaging Het
Apoh A G 11: 108,395,975 N75S probably damaging Het
Arrdc5 T C 17: 56,294,420 E235G possibly damaging Het
Atm T C 9: 53,459,873 D2225G probably damaging Het
Atp6v0a1 C T 11: 101,039,889 P514L possibly damaging Het
Brd9 T A 13: 73,940,741 M195K probably damaging Het
Cacna1a T G 8: 84,556,785 S755A probably damaging Het
Ccdc85c T A 12: 108,274,769 H122L unknown Het
Ccs A T 19: 4,825,865 D192E probably benign Het
Cd3e G A 9: 45,002,161 T92M possibly damaging Het
Celsr2 A G 3: 108,406,963 F1249L possibly damaging Het
Col16a1 G A 4: 130,061,722 probably benign Het
Col17a1 A G 19: 47,680,420 Y122H probably damaging Het
Col28a1 G A 6: 8,083,748 P570S possibly damaging Het
Dchs2 A T 3: 83,346,236 I2318L probably benign Het
Dhx35 T A 2: 158,818,299 Y184N probably benign Het
Dmxl1 T G 18: 49,857,386 N297K probably benign Het
Dsp G A 13: 38,167,609 G135S probably benign Het
Efhb C T 17: 53,398,999 V837I possibly damaging Het
Efs C T 14: 54,921,157 D15N probably damaging Het
Fbxl19 C T 7: 127,752,509 T314I probably damaging Het
Gm11595 A T 11: 99,772,648 C69S unknown Het
Grxcr2 A G 18: 41,986,678 V199A probably benign Het
Hadha T C 5: 30,123,684 E468G probably benign Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hps1 A T 19: 42,770,778 V125E probably damaging Het
Hrg A T 16: 22,953,662 T74S probably benign Het
Idh3a T C 9: 54,586,545 probably benign Het
Leng8 C A 7: 4,145,523 probably null Het
Maml2 TCAGCAGCAGCAGCAGCAGC TCAGCAGCAGCAGCAGC 9: 13,621,399 probably benign Het
Mctp2 T C 7: 72,259,103 H154R probably benign Het
Megf6 A G 4: 154,263,179 E777G probably benign Het
Mgea5 A G 19: 45,776,132 S190P probably damaging Het
Miip A G 4: 147,865,678 S154P probably benign Het
Mprip T C 11: 59,758,425 V985A probably benign Het
Nmrk2 G A 10: 81,199,634 R158W probably damaging Het
Nsd2 T C 5: 33,882,161 S180P probably damaging Het
Olfr1377 G A 11: 50,984,804 M34I probably benign Het
Olfr66 A G 7: 103,881,826 V139A probably damaging Het
Opa1 T G 16: 29,615,134 S596A probably damaging Het
Pcdha2 A G 18: 36,940,804 E496G probably damaging Het
Pcdhb5 T G 18: 37,321,080 V171G probably damaging Het
Pramel6 A G 2: 87,508,659 T68A probably benign Het
Ptprq T C 10: 107,582,358 Y1719C probably damaging Het
Pzp T C 6: 128,513,764 N412S probably benign Het
Rb1cc1 G T 1: 6,249,834 R1159L probably benign Het
Rev3l T A 10: 39,824,150 S1548T probably benign Het
Rora A G 9: 69,378,802 I471M probably benign Het
Scube1 C A 15: 83,651,676 V266L probably benign Het
Sema6a C T 18: 47,283,403 D386N possibly damaging Het
Siglecf T A 7: 43,355,006 L253Q probably damaging Het
Spata31d1b A G 13: 59,715,650 H204R probably benign Het
Syt17 T C 7: 118,408,133 T313A possibly damaging Het
Tbc1d32 T C 10: 56,162,208 T578A possibly damaging Het
Trpm1 A G 7: 64,268,702 S597G probably benign Het
Vmn2r9 T A 5: 108,848,260 H174L probably damaging Het
Vrk2 A T 11: 26,486,975 S281T probably benign Het
Zfp408 C A 2: 91,649,291 V61L probably benign Het
Zfp652 G A 11: 95,749,863 A205T probably benign Het
Other mutations in Wdr48
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Wdr48 APN 9 119905390 missense probably damaging 1.00
IGL02005:Wdr48 APN 9 119905389 missense probably damaging 1.00
IGL02097:Wdr48 APN 9 119924263 missense probably damaging 1.00
IGL02217:Wdr48 APN 9 119909535 missense probably benign 0.01
IGL02416:Wdr48 APN 9 119924760 missense probably damaging 0.98
IGL03198:Wdr48 APN 9 119912413 missense probably benign 0.01
R0005:Wdr48 UTSW 9 119909434 missense probably benign 0.01
R0109:Wdr48 UTSW 9 119918568 splice site probably benign
R1753:Wdr48 UTSW 9 119924247 nonsense probably null
R1829:Wdr48 UTSW 9 119904330 missense probably benign 0.03
R1837:Wdr48 UTSW 9 119905416 missense probably damaging 0.99
R1881:Wdr48 UTSW 9 119909540 missense probably benign 0.00
R1916:Wdr48 UTSW 9 119912417 missense probably benign 0.01
R2039:Wdr48 UTSW 9 119909387 missense probably damaging 1.00
R2421:Wdr48 UTSW 9 119902404 missense probably damaging 1.00
R3031:Wdr48 UTSW 9 119924110 missense probably benign 0.02
R3719:Wdr48 UTSW 9 119907131 missense probably damaging 1.00
R6014:Wdr48 UTSW 9 119924709 missense probably damaging 1.00
R6182:Wdr48 UTSW 9 119924766 missense probably damaging 1.00
R6285:Wdr48 UTSW 9 119920610 missense probably damaging 1.00
R6434:Wdr48 UTSW 9 119916813 missense possibly damaging 0.94
R7167:Wdr48 UTSW 9 119907789 critical splice donor site probably null
R7282:Wdr48 UTSW 9 119911081 missense probably damaging 1.00
R7567:Wdr48 UTSW 9 119916828 missense possibly damaging 0.66
R7912:Wdr48 UTSW 9 119904339 missense probably damaging 1.00
R7993:Wdr48 UTSW 9 119904339 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCGTTTCCTCTCCAGAATG -3'
(R):5'- TTCTGAGACCACTGCTAGAGAC -3'

Sequencing Primer
(F):5'- CCTCTCCAGAATGTAATAGTTGGC -3'
(R):5'- TGAGTAGGAGTGTCCCCATAGACTC -3'
Posted On2017-07-14