Incidental Mutation 'R6054:Rb1cc1'
Institutional Source Beutler Lab
Gene Symbol Rb1cc1
Ensembl Gene ENSMUSG00000025907
Gene NameRB1-inducible coiled-coil 1
SynonymsCc1, 2900055E04Rik, LaXp180, 5930404L04Rik, Fip200
MMRRC Submission 044222-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6054 (G1)
Quality Score225.009
Status Not validated
Chromosomal Location6206197-6276648 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 6249834 bp
Amino Acid Change Arginine to Leucine at position 1159 (R1159L)
Ref Sequence ENSEMBL: ENSMUSP00000027040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027040] [ENSMUST00000162795]
Predicted Effect probably benign
Transcript: ENSMUST00000027040
AA Change: R1159L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000027040
Gene: ENSMUSG00000025907
AA Change: R1159L

SCOP:d1euvb_ 1 51 7e-4 SMART
Blast:UBQ 3 76 8e-12 BLAST
low complexity region 471 486 N/A INTRINSIC
low complexity region 643 653 N/A INTRINSIC
low complexity region 658 674 N/A INTRINSIC
coiled coil region 859 921 N/A INTRINSIC
low complexity region 1033 1045 N/A INTRINSIC
low complexity region 1055 1066 N/A INTRINSIC
SCOP:d1eq1a_ 1159 1305 1e-3 SMART
low complexity region 1374 1388 N/A INTRINSIC
Pfam:ATG11 1447 1583 5.6e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159206
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159661
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159802
Predicted Effect unknown
Transcript: ENSMUST00000161327
AA Change: R1038L
SMART Domains Protein: ENSMUSP00000125348
Gene: ENSMUSG00000025907
AA Change: R1038L

low complexity region 351 366 N/A INTRINSIC
low complexity region 523 533 N/A INTRINSIC
low complexity region 538 554 N/A INTRINSIC
coiled coil region 738 800 N/A INTRINSIC
low complexity region 913 925 N/A INTRINSIC
low complexity region 935 946 N/A INTRINSIC
SCOP:d1eq1a_ 1039 1174 3e-3 SMART
low complexity region 1254 1268 N/A INTRINSIC
Pfam:ATG11 1327 1463 6.7e-28 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000162257
AA Change: R249L
SMART Domains Protein: ENSMUSP00000125334
Gene: ENSMUSG00000025907
AA Change: R249L

coiled coil region 33 331 N/A INTRINSIC
low complexity region 335 355 N/A INTRINSIC
coiled coil region 363 483 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162795
SMART Domains Protein: ENSMUSP00000124676
Gene: ENSMUSG00000025907

SCOP:d1euvb_ 1 51 2e-4 SMART
Blast:UBQ 3 76 4e-12 BLAST
low complexity region 454 469 N/A INTRINSIC
low complexity region 626 636 N/A INTRINSIC
low complexity region 641 657 N/A INTRINSIC
coiled coil region 842 865 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with signaling pathways to coordinately regulate cell growth, cell proliferation, apoptosis, autophagy, and cell migration. This tumor suppressor also enhances retinoblastoma 1 gene expression in cancer cells. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality at mid/late gestation associated with heart failure and liver degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,835,865 S93P unknown Het
Adam28 T A 14: 68,642,152 N149I probably benign Het
Adam4 A C 12: 81,420,054 F598V probably damaging Het
Adh5 A G 3: 138,445,375 H33R possibly damaging Het
Apoh A G 11: 108,395,975 N75S probably damaging Het
Arrdc5 T C 17: 56,294,420 E235G possibly damaging Het
Atm T C 9: 53,459,873 D2225G probably damaging Het
Atp6v0a1 C T 11: 101,039,889 P514L possibly damaging Het
Brd9 T A 13: 73,940,741 M195K probably damaging Het
Cacna1a T G 8: 84,556,785 S755A probably damaging Het
Ccdc85c T A 12: 108,274,769 H122L unknown Het
Ccs A T 19: 4,825,865 D192E probably benign Het
Cd3e G A 9: 45,002,161 T92M possibly damaging Het
Celsr2 A G 3: 108,406,963 F1249L possibly damaging Het
Col16a1 G A 4: 130,061,722 probably benign Het
Col17a1 A G 19: 47,680,420 Y122H probably damaging Het
Col28a1 G A 6: 8,083,748 P570S possibly damaging Het
Dchs2 A T 3: 83,346,236 I2318L probably benign Het
Dhx35 T A 2: 158,818,299 Y184N probably benign Het
Dmxl1 T G 18: 49,857,386 N297K probably benign Het
Dsp G A 13: 38,167,609 G135S probably benign Het
Efhb C T 17: 53,398,999 V837I possibly damaging Het
Efs C T 14: 54,921,157 D15N probably damaging Het
Fbxl19 C T 7: 127,752,509 T314I probably damaging Het
Gm11595 A T 11: 99,772,648 C69S unknown Het
Grxcr2 A G 18: 41,986,678 V199A probably benign Het
Hadha T C 5: 30,123,684 E468G probably benign Het
Hps1 A T 19: 42,770,778 V125E probably damaging Het
Hrg A T 16: 22,953,662 T74S probably benign Het
Idh3a T C 9: 54,586,545 probably benign Het
Leng8 C A 7: 4,145,523 probably null Het
Maml2 TCAGCAGCAGCAGCAGCAGC TCAGCAGCAGCAGCAGC 9: 13,621,399 probably benign Het
Mctp2 T C 7: 72,259,103 H154R probably benign Het
Megf6 A G 4: 154,263,179 E777G probably benign Het
Mgea5 A G 19: 45,776,132 S190P probably damaging Het
Miip A G 4: 147,865,678 S154P probably benign Het
Mprip T C 11: 59,758,425 V985A probably benign Het
Nmrk2 G A 10: 81,199,634 R158W probably damaging Het
Nsd2 T C 5: 33,882,161 S180P probably damaging Het
Olfr1377 G A 11: 50,984,804 M34I probably benign Het
Olfr66 A G 7: 103,881,826 V139A probably damaging Het
Opa1 T G 16: 29,615,134 S596A probably damaging Het
Pcdha2 A G 18: 36,940,804 E496G probably damaging Het
Pcdhb5 T G 18: 37,321,080 V171G probably damaging Het
Pramel6 A G 2: 87,508,659 T68A probably benign Het
Ptprq T C 10: 107,582,358 Y1719C probably damaging Het
Pzp T C 6: 128,513,764 N412S probably benign Het
Rev3l T A 10: 39,824,150 S1548T probably benign Het
Rora A G 9: 69,378,802 I471M probably benign Het
Scube1 C A 15: 83,651,676 V266L probably benign Het
Sema6a C T 18: 47,283,403 D386N possibly damaging Het
Siglecf T A 7: 43,355,006 L253Q probably damaging Het
Spata31d1b A G 13: 59,715,650 H204R probably benign Het
Syt17 T C 7: 118,408,133 T313A possibly damaging Het
Tbc1d32 T C 10: 56,162,208 T578A possibly damaging Het
Trpm1 A G 7: 64,268,702 S597G probably benign Het
Vmn2r9 T A 5: 108,848,260 H174L probably damaging Het
Vrk2 A T 11: 26,486,975 S281T probably benign Het
Wdr48 A G 9: 119,907,777 D22G probably damaging Het
Zfp408 C A 2: 91,649,291 V61L probably benign Het
Zfp652 G A 11: 95,749,863 A205T probably benign Het
Other mutations in Rb1cc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Rb1cc1 APN 1 6249506 missense probably damaging 0.97
IGL00590:Rb1cc1 APN 1 6238296 missense probably damaging 1.00
IGL00678:Rb1cc1 APN 1 6234085 missense probably damaging 1.00
IGL00705:Rb1cc1 APN 1 6244133 missense probably benign 0.00
IGL00957:Rb1cc1 APN 1 6249539 missense probably damaging 1.00
IGL01363:Rb1cc1 APN 1 6250109 missense probably benign 0.06
IGL01599:Rb1cc1 APN 1 6248771 nonsense probably null
IGL01610:Rb1cc1 APN 1 6248481 missense probably benign 0.03
IGL01929:Rb1cc1 APN 1 6240159 missense possibly damaging 0.82
IGL01978:Rb1cc1 APN 1 6238368 missense probably damaging 1.00
IGL02312:Rb1cc1 APN 1 6265623 critical splice donor site probably null
IGL02471:Rb1cc1 APN 1 6240051 missense probably benign 0.01
IGL02677:Rb1cc1 APN 1 6249419 missense probably benign
IGL02702:Rb1cc1 APN 1 6240023 missense probably damaging 0.99
IGL02816:Rb1cc1 APN 1 6262828 splice site probably benign
IGL02899:Rb1cc1 APN 1 6264583 missense probably damaging 1.00
fingerling UTSW 1 6261032 missense probably damaging 1.00
tots UTSW 1 6245637 missense probably damaging 0.99
IGL02988:Rb1cc1 UTSW 1 6247811 critical splice donor site probably null
R0020:Rb1cc1 UTSW 1 6264548 missense possibly damaging 0.86
R0254:Rb1cc1 UTSW 1 6262847 missense probably damaging 1.00
R0390:Rb1cc1 UTSW 1 6248634 missense probably damaging 1.00
R0466:Rb1cc1 UTSW 1 6263267 splice site probably null
R0482:Rb1cc1 UTSW 1 6240323 missense probably damaging 1.00
R0510:Rb1cc1 UTSW 1 6249171 missense probably benign 0.00
R0512:Rb1cc1 UTSW 1 6248543 missense probably damaging 1.00
R0616:Rb1cc1 UTSW 1 6244262 missense possibly damaging 0.80
R0617:Rb1cc1 UTSW 1 6248790 missense possibly damaging 0.83
R0837:Rb1cc1 UTSW 1 6234271 splice site probably null
R1399:Rb1cc1 UTSW 1 6249818 missense probably benign 0.00
R1532:Rb1cc1 UTSW 1 6249734 missense probably benign 0.00
R1542:Rb1cc1 UTSW 1 6244249 missense possibly damaging 0.82
R1746:Rb1cc1 UTSW 1 6263013 splice site probably null
R1764:Rb1cc1 UTSW 1 6214680 intron probably benign
R1968:Rb1cc1 UTSW 1 6248195 splice site probably null
R2025:Rb1cc1 UTSW 1 6245309 missense probably damaging 1.00
R2076:Rb1cc1 UTSW 1 6250038 missense possibly damaging 0.82
R2101:Rb1cc1 UTSW 1 6249335 missense probably benign
R2249:Rb1cc1 UTSW 1 6272724 missense probably damaging 1.00
R3176:Rb1cc1 UTSW 1 6249366 missense probably benign
R3276:Rb1cc1 UTSW 1 6249366 missense probably benign
R3716:Rb1cc1 UTSW 1 6270690 critical splice acceptor site probably null
R3747:Rb1cc1 UTSW 1 6248742 missense possibly damaging 0.92
R3850:Rb1cc1 UTSW 1 6250113 missense probably benign 0.22
R3967:Rb1cc1 UTSW 1 6248270 splice site probably benign
R3969:Rb1cc1 UTSW 1 6248270 splice site probably benign
R3972:Rb1cc1 UTSW 1 6249000 missense probably benign 0.00
R4166:Rb1cc1 UTSW 1 6265663 intron probably benign
R4168:Rb1cc1 UTSW 1 6230024 missense probably damaging 1.00
R4358:Rb1cc1 UTSW 1 6245637 missense probably damaging 0.99
R4370:Rb1cc1 UTSW 1 6248547 missense probably damaging 1.00
R4869:Rb1cc1 UTSW 1 6215021 intron probably benign
R4945:Rb1cc1 UTSW 1 6249627 missense probably benign 0.24
R5111:Rb1cc1 UTSW 1 6214634 intron probably benign
R5175:Rb1cc1 UTSW 1 6248321 missense probably benign
R5196:Rb1cc1 UTSW 1 6234230 missense probably damaging 0.99
R5271:Rb1cc1 UTSW 1 6249193 nonsense probably null
R5341:Rb1cc1 UTSW 1 6215042 intron probably benign
R5952:Rb1cc1 UTSW 1 6248182 missense probably benign
R5992:Rb1cc1 UTSW 1 6233996 missense probably damaging 1.00
R6064:Rb1cc1 UTSW 1 6249734 missense probably benign 0.00
R6313:Rb1cc1 UTSW 1 6244133 missense probably benign 0.00
R6345:Rb1cc1 UTSW 1 6263257 missense probably benign 0.00
R6488:Rb1cc1 UTSW 1 6270727 missense probably damaging 0.97
R6566:Rb1cc1 UTSW 1 6249092 missense probably benign 0.15
R6739:Rb1cc1 UTSW 1 6234230 missense probably damaging 0.99
R6829:Rb1cc1 UTSW 1 6249264 missense probably benign 0.04
R6945:Rb1cc1 UTSW 1 6261032 missense probably damaging 1.00
R6976:Rb1cc1 UTSW 1 6262902 missense probably benign 0.01
R7031:Rb1cc1 UTSW 1 6238466 critical splice donor site probably null
R7066:Rb1cc1 UTSW 1 6250005 missense possibly damaging 0.69
R7185:Rb1cc1 UTSW 1 6238383 missense probably damaging 1.00
R7276:Rb1cc1 UTSW 1 6249192 missense probably benign 0.13
R7448:Rb1cc1 UTSW 1 6245503 missense probably damaging 1.00
R7463:Rb1cc1 UTSW 1 6249180 missense probably benign
R7484:Rb1cc1 UTSW 1 6274217 missense probably damaging 1.00
R7496:Rb1cc1 UTSW 1 6248191 missense probably null 0.02
R7618:Rb1cc1 UTSW 1 6265558 splice site probably null
R7681:Rb1cc1 UTSW 1 6240323 missense probably damaging 1.00
R7774:Rb1cc1 UTSW 1 6248085 missense possibly damaging 0.63
R7780:Rb1cc1 UTSW 1 6248914 nonsense probably null
R7947:Rb1cc1 UTSW 1 6248562 missense probably damaging 1.00
R8057:Rb1cc1 UTSW 1 6245219 missense probably damaging 1.00
R8094:Rb1cc1 UTSW 1 6263224 nonsense probably null
R8527:Rb1cc1 UTSW 1 6244875 missense probably damaging 1.00
R8758:Rb1cc1 UTSW 1 6240227 missense probably benign 0.10
Z1088:Rb1cc1 UTSW 1 6249018 frame shift probably null
Predicted Primers PCR Primer

Sequencing Primer
Posted On2017-07-14