Incidental Mutation 'R8373:Wdr48'
ID 646546
Institutional Source Beutler Lab
Gene Symbol Wdr48
Ensembl Gene ENSMUSG00000032512
Gene Name WD repeat domain 48
Synonyms Uaf1, 8430408H12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8373 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 119894878-119926587 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 119905494 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 160 (T160A)
Ref Sequence ENSEMBL: ENSMUSP00000042509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036561] [ENSMUST00000177637] [ENSMUST00000215167] [ENSMUST00000215307] [ENSMUST00000217472]
AlphaFold Q8BH57
Predicted Effect probably damaging
Transcript: ENSMUST00000036561
AA Change: T160A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042509
Gene: ENSMUSG00000032512
AA Change: T160A

DomainStartEndE-ValueType
WD40 14 58 2.88e-1 SMART
WD40 64 103 2.1e-7 SMART
WD40 106 145 1.37e-6 SMART
WD40 157 196 5.39e-5 SMART
WD40 199 238 1.62e-8 SMART
WD40 241 280 4.62e-4 SMART
WD40 350 388 8.84e1 SMART
low complexity region 460 471 N/A INTRINSIC
Pfam:DUF3337 509 673 1.1e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177637
SMART Domains Protein: ENSMUSP00000136413
Gene: ENSMUSG00000052336

DomainStartEndE-ValueType
Pfam:7tm_1 49 294 3.5e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215167
Predicted Effect probably damaging
Transcript: ENSMUST00000215307
AA Change: T160A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000217472
AA Change: T160A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has been shown to interact with ubiquitin specific peptidase 1 (USP1), activating the deubiquitinating activity of USP1 and allowing it to remove the ubiquitin moiety from monoubiquitinated FANCD2. FANCD2 is ubiquitinated in response to DNA damage. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality prior to E10.5 with reduced embryonic growth. Mice heterozygous for this allele exhibit reduced weight at birth, skeletal defects and reduced female and male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik T G 6: 41,031,688 T231P possibly damaging Het
Adgrg6 T C 10: 14,467,334 T290A probably benign Het
Aff4 C T 11: 53,400,267 Q685* probably null Het
Ankmy1 A G 1: 92,896,094 M150T probably damaging Het
Armc1 T C 3: 19,149,567 Y65C probably damaging Het
Armc8 A G 9: 99,527,099 V222A probably benign Het
Bcar1 A T 8: 111,715,738 Y228* probably null Het
Cct2 T C 10: 117,060,824 D158G possibly damaging Het
Cul1 T A 6: 47,515,063 C426S possibly damaging Het
Deup1 G T 9: 15,592,375 L297M possibly damaging Het
Dpp10 A G 1: 123,854,229 S74P possibly damaging Het
Epha4 A G 1: 77,507,079 Y98H possibly damaging Het
Epn3 T G 11: 94,492,936 D296A probably damaging Het
Eri2 A C 7: 119,772,597 I252S probably benign Het
Gm14025 T A 2: 129,038,171 I612F Het
Gp9 C T 6: 87,779,012 T3I probably benign Het
H2-Q5 T A 17: 35,394,456 V55E Het
Kif3c G T 12: 3,366,089 V37L probably benign Het
Lct A T 1: 128,303,840 N757K probably damaging Het
Lhx8 A C 3: 154,324,658 N112K probably damaging Het
Loxl3 T A 6: 83,048,891 S373R possibly damaging Het
Mettl4 G A 17: 94,733,649 T359I probably damaging Het
Mpp7 A G 18: 7,444,096 S109P probably damaging Het
Nckap5 A G 1: 126,026,295 V840A probably benign Het
Ncoa4 T A 14: 32,176,936 L571Q probably damaging Het
Olfr453 T C 6: 42,744,346 F103S probably damaging Het
Olfr46 A T 7: 140,610,295 Y35F possibly damaging Het
Phgdh G A 3: 98,321,245 T204I probably damaging Het
Pla2g4d C T 2: 120,277,499 V310M probably null Het
Psmd12 C T 11: 107,497,624 P421L probably damaging Het
Ptch1 A G 13: 63,541,168 Y432H probably damaging Het
Rapgef1 G A 2: 29,710,231 G655S probably damaging Het
Rilpl2 C A 5: 124,478,034 A18S probably damaging Het
Srsf7 T C 17: 80,205,386 R88G probably benign Het
St6galnac1 T C 11: 116,769,233 K85E possibly damaging Het
Trip12 A T 1: 84,795,767 S49R probably damaging Het
Zfp704 G A 3: 9,609,442 T93M unknown Het
Other mutations in Wdr48
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Wdr48 APN 9 119905390 missense probably damaging 1.00
IGL02005:Wdr48 APN 9 119905389 missense probably damaging 1.00
IGL02097:Wdr48 APN 9 119924263 missense probably damaging 1.00
IGL02217:Wdr48 APN 9 119909535 missense probably benign 0.01
IGL02416:Wdr48 APN 9 119924760 missense probably damaging 0.98
IGL03198:Wdr48 APN 9 119912413 missense probably benign 0.01
R0005:Wdr48 UTSW 9 119909434 missense probably benign 0.01
R0109:Wdr48 UTSW 9 119918568 splice site probably benign
R1753:Wdr48 UTSW 9 119924247 nonsense probably null
R1829:Wdr48 UTSW 9 119904330 missense probably benign 0.03
R1837:Wdr48 UTSW 9 119905416 missense probably damaging 0.99
R1881:Wdr48 UTSW 9 119909540 missense probably benign 0.00
R1916:Wdr48 UTSW 9 119912417 missense probably benign 0.01
R2039:Wdr48 UTSW 9 119909387 missense probably damaging 1.00
R2421:Wdr48 UTSW 9 119902404 missense probably damaging 1.00
R3031:Wdr48 UTSW 9 119924110 missense probably benign 0.02
R3719:Wdr48 UTSW 9 119907131 missense probably damaging 1.00
R6014:Wdr48 UTSW 9 119924709 missense probably damaging 1.00
R6054:Wdr48 UTSW 9 119907777 missense probably damaging 1.00
R6182:Wdr48 UTSW 9 119924766 missense probably damaging 1.00
R6285:Wdr48 UTSW 9 119920610 missense probably damaging 1.00
R6434:Wdr48 UTSW 9 119916813 missense possibly damaging 0.94
R7167:Wdr48 UTSW 9 119907789 critical splice donor site probably null
R7282:Wdr48 UTSW 9 119911081 missense probably damaging 1.00
R7567:Wdr48 UTSW 9 119916828 missense possibly damaging 0.66
R7912:Wdr48 UTSW 9 119904339 missense probably damaging 1.00
R8932:Wdr48 UTSW 9 119911076 missense probably damaging 1.00
R9183:Wdr48 UTSW 9 119920664 missense possibly damaging 0.59
R9390:Wdr48 UTSW 9 119917179 missense probably benign
R9567:Wdr48 UTSW 9 119912388 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTCATGTTGGCGCTCAGTTC -3'
(R):5'- CACATGTTCATGGGTTAGACAG -3'

Sequencing Primer
(F):5'- TCTTCCAACAGAGATCATAGTGTGCC -3'
(R):5'- TCATGGGTTAGACAGGATCCATC -3'
Posted On 2020-09-02