Incidental Mutation 'R8373:Wdr48'
ID646546
Institutional Source Beutler Lab
Gene Symbol Wdr48
Ensembl Gene ENSMUSG00000032512
Gene NameWD repeat domain 48
SynonymsUaf1, 8430408H12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8373 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location119894878-119926587 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119905494 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 160 (T160A)
Ref Sequence ENSEMBL: ENSMUSP00000042509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036561] [ENSMUST00000177637] [ENSMUST00000215167] [ENSMUST00000215307] [ENSMUST00000217472]
Predicted Effect probably damaging
Transcript: ENSMUST00000036561
AA Change: T160A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042509
Gene: ENSMUSG00000032512
AA Change: T160A

DomainStartEndE-ValueType
WD40 14 58 2.88e-1 SMART
WD40 64 103 2.1e-7 SMART
WD40 106 145 1.37e-6 SMART
WD40 157 196 5.39e-5 SMART
WD40 199 238 1.62e-8 SMART
WD40 241 280 4.62e-4 SMART
WD40 350 388 8.84e1 SMART
low complexity region 460 471 N/A INTRINSIC
Pfam:DUF3337 509 673 1.1e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177637
SMART Domains Protein: ENSMUSP00000136413
Gene: ENSMUSG00000052336

DomainStartEndE-ValueType
Pfam:7tm_1 49 294 3.5e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215167
Predicted Effect probably damaging
Transcript: ENSMUST00000215307
AA Change: T160A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000217472
AA Change: T160A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has been shown to interact with ubiquitin specific peptidase 1 (USP1), activating the deubiquitinating activity of USP1 and allowing it to remove the ubiquitin moiety from monoubiquitinated FANCD2. FANCD2 is ubiquitinated in response to DNA damage. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality prior to E10.5 with reduced embryonic growth. Mice heterozygous for this allele exhibit reduced weight at birth, skeletal defects and reduced female and male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik T G 6: 41,031,688 T231P possibly damaging Het
Adgrg6 T C 10: 14,467,334 T290A probably benign Het
Aff4 C T 11: 53,400,267 Q685* probably null Het
Ankmy1 A G 1: 92,896,094 M150T probably damaging Het
Armc1 T C 3: 19,149,567 Y65C probably damaging Het
Armc8 A G 9: 99,527,099 V222A probably benign Het
Bcar1 A T 8: 111,715,738 Y228* probably null Het
Cct2 T C 10: 117,060,824 D158G possibly damaging Het
Cul1 T A 6: 47,515,063 C426S possibly damaging Het
Deup1 G T 9: 15,592,375 L297M possibly damaging Het
Dpp10 A G 1: 123,854,229 S74P possibly damaging Het
Epha4 A G 1: 77,507,079 Y98H possibly damaging Het
Epn3 T G 11: 94,492,936 D296A probably damaging Het
Eri2 A C 7: 119,772,597 I252S probably benign Het
Gm14025 T A 2: 129,038,171 I612F Het
Gp9 C T 6: 87,779,012 T3I probably benign Het
H2-Q5 T A 17: 35,394,456 V55E Het
Kif3c G T 12: 3,366,089 V37L probably benign Het
Lct A T 1: 128,303,840 N757K probably damaging Het
Lhx8 A C 3: 154,324,658 N112K probably damaging Het
Loxl3 T A 6: 83,048,891 S373R possibly damaging Het
Mettl4 G A 17: 94,733,649 T359I probably damaging Het
Mpp7 A G 18: 7,444,096 S109P probably damaging Het
Nckap5 A G 1: 126,026,295 V840A probably benign Het
Ncoa4 T A 14: 32,176,936 L571Q probably damaging Het
Olfr453 T C 6: 42,744,346 F103S probably damaging Het
Olfr46 A T 7: 140,610,295 Y35F possibly damaging Het
Phgdh G A 3: 98,321,245 T204I probably damaging Het
Pla2g4d C T 2: 120,277,499 V310M probably null Het
Psmd12 C T 11: 107,497,624 P421L probably damaging Het
Ptch1 A G 13: 63,541,168 Y432H probably damaging Het
Rapgef1 G A 2: 29,710,231 G655S probably damaging Het
Rilpl2 C A 5: 124,478,034 A18S probably damaging Het
Srsf7 T C 17: 80,205,386 R88G probably benign Het
St6galnac1 T C 11: 116,769,233 K85E possibly damaging Het
Trip12 A T 1: 84,795,767 S49R probably damaging Het
Zfp704 G A 3: 9,609,442 T93M unknown Het
Other mutations in Wdr48
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Wdr48 APN 9 119905390 missense probably damaging 1.00
IGL02005:Wdr48 APN 9 119905389 missense probably damaging 1.00
IGL02097:Wdr48 APN 9 119924263 missense probably damaging 1.00
IGL02217:Wdr48 APN 9 119909535 missense probably benign 0.01
IGL02416:Wdr48 APN 9 119924760 missense probably damaging 0.98
IGL03198:Wdr48 APN 9 119912413 missense probably benign 0.01
R0005:Wdr48 UTSW 9 119909434 missense probably benign 0.01
R0109:Wdr48 UTSW 9 119918568 splice site probably benign
R1753:Wdr48 UTSW 9 119924247 nonsense probably null
R1829:Wdr48 UTSW 9 119904330 missense probably benign 0.03
R1837:Wdr48 UTSW 9 119905416 missense probably damaging 0.99
R1881:Wdr48 UTSW 9 119909540 missense probably benign 0.00
R1916:Wdr48 UTSW 9 119912417 missense probably benign 0.01
R2039:Wdr48 UTSW 9 119909387 missense probably damaging 1.00
R2421:Wdr48 UTSW 9 119902404 missense probably damaging 1.00
R3031:Wdr48 UTSW 9 119924110 missense probably benign 0.02
R3719:Wdr48 UTSW 9 119907131 missense probably damaging 1.00
R6014:Wdr48 UTSW 9 119924709 missense probably damaging 1.00
R6054:Wdr48 UTSW 9 119907777 missense probably damaging 1.00
R6182:Wdr48 UTSW 9 119924766 missense probably damaging 1.00
R6285:Wdr48 UTSW 9 119920610 missense probably damaging 1.00
R6434:Wdr48 UTSW 9 119916813 missense possibly damaging 0.94
R7167:Wdr48 UTSW 9 119907789 critical splice donor site probably null
R7282:Wdr48 UTSW 9 119911081 missense probably damaging 1.00
R7567:Wdr48 UTSW 9 119916828 missense possibly damaging 0.66
R7912:Wdr48 UTSW 9 119904339 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCATGTTGGCGCTCAGTTC -3'
(R):5'- CACATGTTCATGGGTTAGACAG -3'

Sequencing Primer
(F):5'- TCTTCCAACAGAGATCATAGTGTGCC -3'
(R):5'- TCATGGGTTAGACAGGATCCATC -3'
Posted On2020-09-02