Incidental Mutation 'R6054:Apoh'
ID484323
Institutional Source Beutler Lab
Gene Symbol Apoh
Ensembl Gene ENSMUSG00000000049
Gene Nameapolipoprotein H
Synonymsbeta-2-GPI, beta-2-glycoprotein 1, B2GPI
MMRRC Submission 044222-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.505) question?
Stock #R6054 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location108343354-108414396 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108395975 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 75 (N75S)
Ref Sequence ENSEMBL: ENSMUSP00000114214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000049] [ENSMUST00000133383] [ENSMUST00000146050] [ENSMUST00000152958]
Predicted Effect probably damaging
Transcript: ENSMUST00000000049
AA Change: N75S

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000000049
Gene: ENSMUSG00000000049
AA Change: N75S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
CCP 23 79 1.35e-7 SMART
CCP 84 137 2.53e-12 SMART
CCP 142 200 4.92e-10 SMART
CCP 205 260 1.98e-14 SMART
CCP 264 325 2.51e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133383
SMART Domains Protein: ENSMUSP00000115516
Gene: ENSMUSG00000000049

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Sushi 23 51 6.7e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146050
Predicted Effect probably damaging
Transcript: ENSMUST00000152958
AA Change: N75S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114214
Gene: ENSMUSG00000000049
AA Change: N75S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
CCP 23 79 1.35e-7 SMART
CCP 84 137 2.53e-12 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Apolipoprotein H has been implicated in a variety of physiologic pathways including lipoprotein metabolism, coagulation, and the production of antiphospholipid autoantibodies. APOH may be a required cofactor for anionic phospholipid binding by the antiphospholipid autoantibodies found in sera of many patients with lupus and primary antiphospholipid syndrome, but it does not seem to be required for the reactivity of antiphospholipid autoantibodies associated with infections. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in reduced viability and reduced thrombin production. Only 8% homozygous null animals are born from heterozygous intercrosses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,835,865 S93P unknown Het
Adam28 T A 14: 68,642,152 N149I probably benign Het
Adam4 A C 12: 81,420,054 F598V probably damaging Het
Adh5 A G 3: 138,445,375 H33R possibly damaging Het
Arrdc5 T C 17: 56,294,420 E235G possibly damaging Het
Atm T C 9: 53,459,873 D2225G probably damaging Het
Atp6v0a1 C T 11: 101,039,889 P514L possibly damaging Het
Brd9 T A 13: 73,940,741 M195K probably damaging Het
Cacna1a T G 8: 84,556,785 S755A probably damaging Het
Ccdc85c T A 12: 108,274,769 H122L unknown Het
Ccs A T 19: 4,825,865 D192E probably benign Het
Cd3e G A 9: 45,002,161 T92M possibly damaging Het
Celsr2 A G 3: 108,406,963 F1249L possibly damaging Het
Col16a1 G A 4: 130,061,722 probably benign Het
Col17a1 A G 19: 47,680,420 Y122H probably damaging Het
Col28a1 G A 6: 8,083,748 P570S possibly damaging Het
Dchs2 A T 3: 83,346,236 I2318L probably benign Het
Dhx35 T A 2: 158,818,299 Y184N probably benign Het
Dmxl1 T G 18: 49,857,386 N297K probably benign Het
Dsp G A 13: 38,167,609 G135S probably benign Het
Efhb C T 17: 53,398,999 V837I possibly damaging Het
Efs C T 14: 54,921,157 D15N probably damaging Het
Fbxl19 C T 7: 127,752,509 T314I probably damaging Het
Gm11595 A T 11: 99,772,648 C69S unknown Het
Grxcr2 A G 18: 41,986,678 V199A probably benign Het
Hadha T C 5: 30,123,684 E468G probably benign Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hps1 A T 19: 42,770,778 V125E probably damaging Het
Hrg A T 16: 22,953,662 T74S probably benign Het
Idh3a T C 9: 54,586,545 probably benign Het
Leng8 C A 7: 4,145,523 probably null Het
Maml2 TCAGCAGCAGCAGCAGCAGC TCAGCAGCAGCAGCAGC 9: 13,621,399 probably benign Het
Mctp2 T C 7: 72,259,103 H154R probably benign Het
Megf6 A G 4: 154,263,179 E777G probably benign Het
Mgea5 A G 19: 45,776,132 S190P probably damaging Het
Miip A G 4: 147,865,678 S154P probably benign Het
Mprip T C 11: 59,758,425 V985A probably benign Het
Nmrk2 G A 10: 81,199,634 R158W probably damaging Het
Nsd2 T C 5: 33,882,161 S180P probably damaging Het
Olfr1377 G A 11: 50,984,804 M34I probably benign Het
Olfr66 A G 7: 103,881,826 V139A probably damaging Het
Opa1 T G 16: 29,615,134 S596A probably damaging Het
Pcdha2 A G 18: 36,940,804 E496G probably damaging Het
Pcdhb5 T G 18: 37,321,080 V171G probably damaging Het
Pramel6 A G 2: 87,508,659 T68A probably benign Het
Ptprq T C 10: 107,582,358 Y1719C probably damaging Het
Pzp T C 6: 128,513,764 N412S probably benign Het
Rb1cc1 G T 1: 6,249,834 R1159L probably benign Het
Rev3l T A 10: 39,824,150 S1548T probably benign Het
Rora A G 9: 69,378,802 I471M probably benign Het
Scube1 C A 15: 83,651,676 V266L probably benign Het
Sema6a C T 18: 47,283,403 D386N possibly damaging Het
Siglecf T A 7: 43,355,006 L253Q probably damaging Het
Spata31d1b A G 13: 59,715,650 H204R probably benign Het
Syt17 T C 7: 118,408,133 T313A possibly damaging Het
Tbc1d32 T C 10: 56,162,208 T578A possibly damaging Het
Trpm1 A G 7: 64,268,702 S597G probably benign Het
Vmn2r9 T A 5: 108,848,260 H174L probably damaging Het
Vrk2 A T 11: 26,486,975 S281T probably benign Het
Wdr48 A G 9: 119,907,777 D22G probably damaging Het
Zfp408 C A 2: 91,649,291 V61L probably benign Het
Zfp652 G A 11: 95,749,863 A205T probably benign Het
Other mutations in Apoh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Apoh APN 11 108395834 missense probably benign 0.45
IGL01327:Apoh APN 11 108397361 missense probably damaging 1.00
IGL01353:Apoh APN 11 108397385 missense probably damaging 1.00
IGL01464:Apoh APN 11 108395890 missense probably damaging 1.00
IGL02065:Apoh APN 11 108414305 utr 3 prime probably benign
IGL02646:Apoh APN 11 108412142 missense probably benign 0.15
R0125:Apoh UTSW 11 108412073 missense probably damaging 1.00
R0359:Apoh UTSW 11 108397373 missense probably damaging 1.00
R1969:Apoh UTSW 11 108407462 missense probably benign 0.00
R2280:Apoh UTSW 11 108409180 nonsense probably null
R2568:Apoh UTSW 11 108404871 missense probably benign 0.00
R4369:Apoh UTSW 11 108397379 missense probably damaging 1.00
R4789:Apoh UTSW 11 108409238 missense probably damaging 1.00
R4824:Apoh UTSW 11 108414261 missense probably benign 0.37
R4937:Apoh UTSW 11 108407378 missense probably benign 0.19
R5634:Apoh UTSW 11 108412049 missense probably damaging 1.00
R5900:Apoh UTSW 11 108412017 missense probably damaging 0.99
R5951:Apoh UTSW 11 108395903 missense probably damaging 1.00
R6126:Apoh UTSW 11 108397373 missense probably damaging 1.00
R7343:Apoh UTSW 11 108395848 missense probably benign 0.14
R7471:Apoh UTSW 11 108407305 missense probably damaging 1.00
X0065:Apoh UTSW 11 108395350 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGTTCAGTCTGTCCGAAGC -3'
(R):5'- TGGCAACACTTCTCCACTAC -3'

Sequencing Primer
(F):5'- GAAGCCGGATGACCTACCATTTG -3'
(R):5'- GGCAACACTTCTCCACTACTTGTC -3'
Posted On2017-07-14