Incidental Mutation 'R6054:Megf6'
ID484293
Institutional Source Beutler Lab
Gene Symbol Megf6
Ensembl Gene ENSMUSG00000057751
Gene Namemultiple EGF-like-domains 6
Synonyms2600001P17Rik, Egfl3
MMRRC Submission 044222-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6054 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location154170730-154275713 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 154263179 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 777 (E777G)
Ref Sequence ENSEMBL: ENSMUSP00000030897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030897] [ENSMUST00000152159]
Predicted Effect probably benign
Transcript: ENSMUST00000030897
AA Change: E777G

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000030897
Gene: ENSMUSG00000057751
AA Change: E777G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
EGF_CA 122 162 1.54e-6 SMART
EGF_CA 163 203 2.08e-12 SMART
EGF 207 245 5.4e-2 SMART
EGF 249 286 2.39e-3 SMART
EGF_CA 287 327 4.96e-10 SMART
EGF 336 373 1.64e-1 SMART
EGF 377 413 1.99e1 SMART
EGF_CA 414 454 7.4e-9 SMART
EGF 521 554 4.26e0 SMART
EGF_Lam 570 609 1.19e-3 SMART
EGF_like 613 652 5.29e-1 SMART
EGF 642 685 2.2e1 SMART
EGF_Lam 656 697 1.04e-3 SMART
EGF 687 730 1.59e1 SMART
EGF_like 701 742 2.27e0 SMART
EGF_Lam 746 784 1.33e-1 SMART
EGF 783 816 2.85e-1 SMART
EGF_Lam 832 871 3.88e-3 SMART
EGF_Lam 875 915 3.25e-5 SMART
EGF 914 946 4.7e-2 SMART
EGF_like 962 1001 1.69e-1 SMART
EGF 1000 1032 7.02e-1 SMART
EGF_Lam 1048 1087 3.1e-2 SMART
EGF 1077 1118 7.53e-1 SMART
EGF_like 1091 1130 5.59e-1 SMART
EGF 1129 1161 5.04e-2 SMART
EGF_Lam 1177 1216 2.94e-3 SMART
EGF 1206 1248 1.87e1 SMART
EGF_Lam 1220 1260 3.1e-2 SMART
EGF 1259 1291 1.73e0 SMART
EGF 1302 1334 6.55e-1 SMART
EGF 1345 1377 4.39e-2 SMART
EGF_Lam 1393 1432 7.64e-2 SMART
EGF_Lam 1436 1475 2.64e-5 SMART
EGF_like 1465 1506 4.2e1 SMART
EGF_Lam 1479 1518 1.19e-3 SMART
EGF 1517 1549 1.84e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127088
Predicted Effect probably benign
Transcript: ENSMUST00000128700
SMART Domains Protein: ENSMUSP00000117277
Gene: ENSMUSG00000057751

DomainStartEndE-ValueType
EGF_Lam 3 42 3.1e-2 SMART
EGF 32 73 7.53e-1 SMART
EGF_like 46 85 8.92e-1 SMART
EGF 84 116 7.13e-2 SMART
EGF 127 159 1.73e0 SMART
EGF 170 202 6.55e-1 SMART
EGF 213 245 4.39e-2 SMART
EGF_Lam 261 300 7.64e-2 SMART
EGF 299 331 1.51e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152159
AA Change: E669G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000121641
Gene: ENSMUSG00000057751
AA Change: E669G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF_CA 55 95 2.08e-12 SMART
EGF 99 137 5.4e-2 SMART
EGF 141 178 2.39e-3 SMART
EGF_CA 179 219 4.96e-10 SMART
EGF 228 265 1.64e-1 SMART
EGF 269 305 1.99e1 SMART
EGF_CA 306 346 7.4e-9 SMART
EGF 413 446 4.26e0 SMART
EGF_Lam 462 501 1.19e-3 SMART
EGF_like 505 544 5.29e-1 SMART
EGF 534 577 2.2e1 SMART
EGF_Lam 548 589 1.04e-3 SMART
EGF 579 622 1.59e1 SMART
EGF_like 593 634 2.27e0 SMART
EGF_Lam 638 676 1.33e-1 SMART
EGF 675 708 2.85e-1 SMART
EGF_Lam 724 763 3.88e-3 SMART
EGF_Lam 767 807 3.25e-5 SMART
EGF 806 838 4.7e-2 SMART
EGF_Lam 854 893 2.56e-3 SMART
EGF 892 924 2.02e-1 SMART
EGF 935 967 7.13e-2 SMART
EGF 978 1010 1.73e0 SMART
EGF 1021 1053 6.55e-1 SMART
EGF 1064 1096 4.39e-2 SMART
EGF 1107 1139 4.97e-1 SMART
EGF 1159 1191 1.84e1 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,835,865 S93P unknown Het
Adam28 T A 14: 68,642,152 N149I probably benign Het
Adam4 A C 12: 81,420,054 F598V probably damaging Het
Adh5 A G 3: 138,445,375 H33R possibly damaging Het
Apoh A G 11: 108,395,975 N75S probably damaging Het
Arrdc5 T C 17: 56,294,420 E235G possibly damaging Het
Atm T C 9: 53,459,873 D2225G probably damaging Het
Atp6v0a1 C T 11: 101,039,889 P514L possibly damaging Het
Brd9 T A 13: 73,940,741 M195K probably damaging Het
Cacna1a T G 8: 84,556,785 S755A probably damaging Het
Ccdc85c T A 12: 108,274,769 H122L unknown Het
Ccs A T 19: 4,825,865 D192E probably benign Het
Cd3e G A 9: 45,002,161 T92M possibly damaging Het
Celsr2 A G 3: 108,406,963 F1249L possibly damaging Het
Col16a1 G A 4: 130,061,722 probably benign Het
Col17a1 A G 19: 47,680,420 Y122H probably damaging Het
Col28a1 G A 6: 8,083,748 P570S possibly damaging Het
Dchs2 A T 3: 83,346,236 I2318L probably benign Het
Dhx35 T A 2: 158,818,299 Y184N probably benign Het
Dmxl1 T G 18: 49,857,386 N297K probably benign Het
Dsp G A 13: 38,167,609 G135S probably benign Het
Efhb C T 17: 53,398,999 V837I possibly damaging Het
Efs C T 14: 54,921,157 D15N probably damaging Het
Fbxl19 C T 7: 127,752,509 T314I probably damaging Het
Gm11595 A T 11: 99,772,648 C69S unknown Het
Grxcr2 A G 18: 41,986,678 V199A probably benign Het
Hadha T C 5: 30,123,684 E468G probably benign Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hps1 A T 19: 42,770,778 V125E probably damaging Het
Hrg A T 16: 22,953,662 T74S probably benign Het
Idh3a T C 9: 54,586,545 probably benign Het
Leng8 C A 7: 4,145,523 probably null Het
Maml2 TCAGCAGCAGCAGCAGCAGC TCAGCAGCAGCAGCAGC 9: 13,621,399 probably benign Het
Mctp2 T C 7: 72,259,103 H154R probably benign Het
Mgea5 A G 19: 45,776,132 S190P probably damaging Het
Miip A G 4: 147,865,678 S154P probably benign Het
Mprip T C 11: 59,758,425 V985A probably benign Het
Nmrk2 G A 10: 81,199,634 R158W probably damaging Het
Nsd2 T C 5: 33,882,161 S180P probably damaging Het
Olfr1377 G A 11: 50,984,804 M34I probably benign Het
Olfr66 A G 7: 103,881,826 V139A probably damaging Het
Opa1 T G 16: 29,615,134 S596A probably damaging Het
Pcdha2 A G 18: 36,940,804 E496G probably damaging Het
Pcdhb5 T G 18: 37,321,080 V171G probably damaging Het
Pramel6 A G 2: 87,508,659 T68A probably benign Het
Ptprq T C 10: 107,582,358 Y1719C probably damaging Het
Pzp T C 6: 128,513,764 N412S probably benign Het
Rb1cc1 G T 1: 6,249,834 R1159L probably benign Het
Rev3l T A 10: 39,824,150 S1548T probably benign Het
Rora A G 9: 69,378,802 I471M probably benign Het
Scube1 C A 15: 83,651,676 V266L probably benign Het
Sema6a C T 18: 47,283,403 D386N possibly damaging Het
Siglecf T A 7: 43,355,006 L253Q probably damaging Het
Spata31d1b A G 13: 59,715,650 H204R probably benign Het
Syt17 T C 7: 118,408,133 T313A possibly damaging Het
Tbc1d32 T C 10: 56,162,208 T578A possibly damaging Het
Trpm1 A G 7: 64,268,702 S597G probably benign Het
Vmn2r9 T A 5: 108,848,260 H174L probably damaging Het
Vrk2 A T 11: 26,486,975 S281T probably benign Het
Wdr48 A G 9: 119,907,777 D22G probably damaging Het
Zfp408 C A 2: 91,649,291 V61L probably benign Het
Zfp652 G A 11: 95,749,863 A205T probably benign Het
Other mutations in Megf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Megf6 APN 4 154253807 missense probably damaging 1.00
IGL01410:Megf6 APN 4 154252563 critical splice donor site probably null
IGL01512:Megf6 APN 4 154262583 missense possibly damaging 0.64
IGL01824:Megf6 APN 4 154252234 missense probably damaging 1.00
IGL02172:Megf6 APN 4 154270692 missense probably damaging 1.00
IGL02727:Megf6 APN 4 154253149 splice site probably null
IGL02966:Megf6 APN 4 154253777 missense probably damaging 1.00
Didactic UTSW 4 154254587 missense probably damaging 1.00
R0118:Megf6 UTSW 4 154254641 missense probably damaging 0.99
R0220:Megf6 UTSW 4 154258215 missense probably damaging 1.00
R0347:Megf6 UTSW 4 154254635 missense possibly damaging 0.90
R0383:Megf6 UTSW 4 154265326 missense probably benign 0.01
R0417:Megf6 UTSW 4 154267967 missense probably benign 0.06
R0526:Megf6 UTSW 4 154258941 missense probably benign
R0528:Megf6 UTSW 4 154259173 missense probably benign 0.04
R0928:Megf6 UTSW 4 154177047 missense probably damaging 1.00
R1311:Megf6 UTSW 4 154263782 splice site probably null
R1458:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1470:Megf6 UTSW 4 154252419 splice site probably benign
R1476:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1479:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1624:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1626:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1638:Megf6 UTSW 4 154262510 splice site probably benign
R1777:Megf6 UTSW 4 154270690 nonsense probably null
R1831:Megf6 UTSW 4 154270677 missense probably benign 0.00
R1944:Megf6 UTSW 4 154256066 missense possibly damaging 0.75
R1984:Megf6 UTSW 4 154267667 missense probably damaging 1.00
R2109:Megf6 UTSW 4 154177121 missense probably benign 0.39
R2448:Megf6 UTSW 4 154266645 intron probably null
R2880:Megf6 UTSW 4 154252549 missense probably damaging 1.00
R4032:Megf6 UTSW 4 154177093 nonsense probably null
R4058:Megf6 UTSW 4 154242532 splice site probably benign
R4672:Megf6 UTSW 4 154249452 missense probably damaging 0.99
R4688:Megf6 UTSW 4 154253814 missense probably damaging 0.99
R4752:Megf6 UTSW 4 154252438 missense probably damaging 1.00
R4863:Megf6 UTSW 4 154254281 critical splice donor site probably null
R4909:Megf6 UTSW 4 154265391 missense probably damaging 1.00
R4942:Megf6 UTSW 4 154253820 missense probably damaging 1.00
R4981:Megf6 UTSW 4 154267450 missense possibly damaging 0.95
R4990:Megf6 UTSW 4 154267226 missense possibly damaging 0.94
R5001:Megf6 UTSW 4 154268060 missense probably damaging 1.00
R5189:Megf6 UTSW 4 154252523 missense probably benign 0.31
R5210:Megf6 UTSW 4 154269816 intron probably benign
R5220:Megf6 UTSW 4 154253838 critical splice donor site probably null
R5250:Megf6 UTSW 4 154256010 missense possibly damaging 0.65
R5697:Megf6 UTSW 4 154258229 missense probably null 0.15
R5808:Megf6 UTSW 4 154267662 missense probably benign
R5916:Megf6 UTSW 4 154249425 critical splice acceptor site probably null
R6075:Megf6 UTSW 4 154262599 nonsense probably null
R6515:Megf6 UTSW 4 154258919 missense possibly damaging 0.84
R6599:Megf6 UTSW 4 154258087 splice site probably null
R6811:Megf6 UTSW 4 154252161 missense probably damaging 1.00
R6925:Megf6 UTSW 4 154254587 missense probably damaging 1.00
R7023:Megf6 UTSW 4 154254145 missense possibly damaging 0.95
R7117:Megf6 UTSW 4 154258922 missense possibly damaging 0.78
R7163:Megf6 UTSW 4 154267441 missense probably damaging 0.98
R7345:Megf6 UTSW 4 154267315 missense probably benign
R7580:Megf6 UTSW 4 154270744 nonsense probably null
R7649:Megf6 UTSW 4 154265085 missense probably damaging 0.96
R7702:Megf6 UTSW 4 154270470 missense probably benign 0.00
R8010:Megf6 UTSW 4 154270507 missense probably benign 0.13
Z1177:Megf6 UTSW 4 154237826 missense probably benign 0.12
Z1177:Megf6 UTSW 4 154267682 missense probably damaging 0.99
Z1177:Megf6 UTSW 4 154250849 missense probably damaging 1.00
Z1177:Megf6 UTSW 4 154267681 missense possibly damaging 0.48
Z1177:Megf6 UTSW 4 154267747 nonsense probably null
Z1177:Megf6 UTSW 4 154269741 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATTTATAGGTGGTGCCCTGC -3'
(R):5'- AAGCACACCTCATCTGGCAG -3'

Sequencing Primer
(F):5'- CAGCTCTGGGGTTCTGAAAC -3'
(R):5'- ATGAGCATGGCAGCCTG -3'
Posted On2017-07-14