Incidental Mutation 'R6093:Myo19'
ID486056
Institutional Source Beutler Lab
Gene Symbol Myo19
Ensembl Gene ENSMUSG00000020527
Gene Namemyosin XIX
SynonymsMyohd1, 1110055A02Rik
MMRRC Submission 044250-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R6093 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location84880148-84911226 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84885709 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 64 (F64L)
Ref Sequence ENSEMBL: ENSMUSP00000091502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020837] [ENSMUST00000093969]
Predicted Effect probably damaging
Transcript: ENSMUST00000020837
AA Change: F64L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020837
Gene: ENSMUSG00000020527
AA Change: F64L

DomainStartEndE-ValueType
MYSc 29 205 2.18e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000093969
AA Change: F64L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091502
Gene: ENSMUSG00000020527
AA Change: F64L

DomainStartEndE-ValueType
MYSc 29 759 4.07e-219 SMART
IQ 760 782 1.74e1 SMART
IQ 783 804 1.97e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123515
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124152
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124475
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141173
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141705
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A G 2: 68,659,870 probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Adgrl3 A C 5: 81,646,522 R531S probably benign Het
Ahctf1 T C 1: 179,762,952 D1252G probably benign Het
Ano1 T C 7: 144,611,377 N648S possibly damaging Het
Antxr2 C A 5: 98,030,460 L30F probably damaging Het
Apol9a T A 15: 77,404,420 N249I probably benign Het
Atp2a1 A G 7: 126,446,921 V977A probably damaging Het
Clmn T C 12: 104,771,956 T968A probably benign Het
Clstn2 A T 9: 97,458,210 I703N probably damaging Het
Cnot1 T C 8: 95,748,894 T1051A probably benign Het
Csde1 A G 3: 103,052,902 Y615C probably damaging Het
Dcaf17 A G 2: 71,082,012 K314E possibly damaging Het
Dnah10 A T 5: 124,753,174 I711F probably benign Het
Duox1 G T 2: 122,347,274 R1513L probably benign Het
Exph5 A G 9: 53,372,617 T333A possibly damaging Het
Fmnl2 A G 2: 53,114,868 D658G probably damaging Het
Gcgr T A 11: 120,538,121 L395Q probably damaging Het
Gm10801 C CGTA 2: 98,663,807 probably null Het
Gm11487 T C 4: 73,402,021 I174V probably benign Het
Greb1 C T 12: 16,684,486 C1501Y probably benign Het
Iqgap2 A G 13: 95,628,963 V1533A probably damaging Het
Kcnc3 A C 7: 44,591,508 D208A probably benign Het
Kctd14 A G 7: 97,454,953 probably benign Het
Mcm5 C A 8: 75,109,746 D13E probably benign Het
Med23 A G 10: 24,878,443 I221V probably benign Het
Ncapd3 T G 9: 27,056,158 S597A probably damaging Het
Neb A T 2: 52,251,770 Y72* probably null Het
Nrip1 C T 16: 76,294,764 probably benign Het
Olfr196 T A 16: 59,167,967 M59L probably damaging Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Phkb T A 8: 85,942,329 D328E probably damaging Het
Phyh G T 2: 4,919,085 A6S possibly damaging Het
Pole A T 5: 110,312,090 Q1120L probably benign Het
Rbmxl1 T C 8: 78,505,943 Y257C probably damaging Het
Smurf2 A T 11: 106,868,623 H69Q possibly damaging Het
Tmem167b A T 3: 108,562,123 M1K probably null Het
Tmod4 A T 3: 95,125,618 T22S probably benign Het
Triml1 T C 8: 43,140,718 I149M probably benign Het
Vmn2r108 T C 17: 20,481,140 T33A probably benign Het
Vmn2r76 T A 7: 86,228,261 R525* probably null Het
Zfp109 A T 7: 24,229,133 W292R probably benign Het
Zfp292 C T 4: 34,811,902 A381T probably damaging Het
Zfp791 C T 8: 85,113,506 probably null Het
Other mutations in Myo19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Myo19 APN 11 84909498 missense probably benign 0.00
IGL01120:Myo19 APN 11 84907278 missense probably damaging 0.96
IGL01542:Myo19 APN 11 84909546 missense probably damaging 0.96
IGL02341:Myo19 APN 11 84888045 splice site probably benign
IGL02708:Myo19 APN 11 84899396 missense possibly damaging 0.89
IGL03223:Myo19 APN 11 84910471 missense possibly damaging 0.57
R0009:Myo19 UTSW 11 84888169 critical splice donor site probably null
R0125:Myo19 UTSW 11 84888175 splice site probably benign
R0142:Myo19 UTSW 11 84894603 missense probably damaging 1.00
R0226:Myo19 UTSW 11 84897732 splice site probably benign
R0230:Myo19 UTSW 11 84893333 missense possibly damaging 0.91
R0482:Myo19 UTSW 11 84909419 missense probably benign 0.00
R1981:Myo19 UTSW 11 84892170 missense possibly damaging 0.46
R2035:Myo19 UTSW 11 84897608 missense probably benign
R2185:Myo19 UTSW 11 84892221 missense probably benign 0.00
R3176:Myo19 UTSW 11 84892175 missense probably benign 0.01
R3276:Myo19 UTSW 11 84892175 missense probably benign 0.01
R3824:Myo19 UTSW 11 84885679 missense probably damaging 0.98
R3914:Myo19 UTSW 11 84894603 missense probably damaging 1.00
R4333:Myo19 UTSW 11 84908288 missense probably benign 0.00
R4335:Myo19 UTSW 11 84908288 missense probably benign 0.00
R4647:Myo19 UTSW 11 84894642 missense probably damaging 1.00
R4968:Myo19 UTSW 11 84901502 missense probably damaging 1.00
R4971:Myo19 UTSW 11 84892197 missense probably damaging 1.00
R5083:Myo19 UTSW 11 84903211 missense possibly damaging 0.60
R5284:Myo19 UTSW 11 84885272 unclassified probably null
R5558:Myo19 UTSW 11 84910448 missense probably damaging 1.00
R5739:Myo19 UTSW 11 84897624 missense probably damaging 1.00
R5982:Myo19 UTSW 11 84899400 missense probably damaging 0.97
R6444:Myo19 UTSW 11 84895308 missense probably benign
R6657:Myo19 UTSW 11 84897196 missense probably benign
R6945:Myo19 UTSW 11 84897560 missense probably benign 0.06
R7022:Myo19 UTSW 11 84900547 missense probably damaging 0.99
R7058:Myo19 UTSW 11 84907368 missense possibly damaging 0.89
R7150:Myo19 UTSW 11 84905613 missense probably benign
R7155:Myo19 UTSW 11 84900586 missense probably damaging 1.00
R7478:Myo19 UTSW 11 84885800 missense probably benign 0.41
R7486:Myo19 UTSW 11 84905637 missense probably benign
X0053:Myo19 UTSW 11 84897715 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AATTGAGACTCCTGACCTGGC -3'
(R):5'- TTGTTGAGCTAGGACATGGC -3'

Sequencing Primer
(F):5'- GGGACTCGTCTTAATTAGATCTTATG -3'
(R):5'- TTGAGCTAGGACATGGCACCAATAG -3'
Posted On2017-08-16