Incidental Mutation 'R6093:Vmn2r108'
ID486065
Institutional Source Beutler Lab
Gene Symbol Vmn2r108
Ensembl Gene ENSMUSG00000091805
Gene Namevomeronasal 2, receptor 108
SynonymsEG627805
MMRRC Submission 044250-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R6093 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location20462373-20481236 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20481140 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 33 (T33A)
Ref Sequence ENSEMBL: ENSMUSP00000130373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167314]
Predicted Effect probably benign
Transcript: ENSMUST00000167314
AA Change: T33A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000130373
Gene: ENSMUSG00000091805
AA Change: T33A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 83 467 6e-33 PFAM
Pfam:NCD3G 510 563 9.2e-22 PFAM
Pfam:7tm_3 593 831 2.2e-51 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A G 2: 68,659,870 probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Adgrl3 A C 5: 81,646,522 R531S probably benign Het
Ahctf1 T C 1: 179,762,952 D1252G probably benign Het
Ano1 T C 7: 144,611,377 N648S possibly damaging Het
Antxr2 C A 5: 98,030,460 L30F probably damaging Het
Apol9a T A 15: 77,404,420 N249I probably benign Het
Atp2a1 A G 7: 126,446,921 V977A probably damaging Het
Clmn T C 12: 104,771,956 T968A probably benign Het
Clstn2 A T 9: 97,458,210 I703N probably damaging Het
Cnot1 T C 8: 95,748,894 T1051A probably benign Het
Csde1 A G 3: 103,052,902 Y615C probably damaging Het
Dcaf17 A G 2: 71,082,012 K314E possibly damaging Het
Dnah10 A T 5: 124,753,174 I711F probably benign Het
Duox1 G T 2: 122,347,274 R1513L probably benign Het
Exph5 A G 9: 53,372,617 T333A possibly damaging Het
Fmnl2 A G 2: 53,114,868 D658G probably damaging Het
Gcgr T A 11: 120,538,121 L395Q probably damaging Het
Gm10801 C CGTA 2: 98,663,807 probably null Het
Gm11487 T C 4: 73,402,021 I174V probably benign Het
Greb1 C T 12: 16,684,486 C1501Y probably benign Het
Iqgap2 A G 13: 95,628,963 V1533A probably damaging Het
Kcnc3 A C 7: 44,591,508 D208A probably benign Het
Kctd14 A G 7: 97,454,953 probably benign Het
Mcm5 C A 8: 75,109,746 D13E probably benign Het
Med23 A G 10: 24,878,443 I221V probably benign Het
Myo19 T C 11: 84,885,709 F64L probably damaging Het
Ncapd3 T G 9: 27,056,158 S597A probably damaging Het
Neb A T 2: 52,251,770 Y72* probably null Het
Nrip1 C T 16: 76,294,764 probably benign Het
Olfr196 T A 16: 59,167,967 M59L probably damaging Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Phkb T A 8: 85,942,329 D328E probably damaging Het
Phyh G T 2: 4,919,085 A6S possibly damaging Het
Pole A T 5: 110,312,090 Q1120L probably benign Het
Rbmxl1 T C 8: 78,505,943 Y257C probably damaging Het
Smurf2 A T 11: 106,868,623 H69Q possibly damaging Het
Tmem167b A T 3: 108,562,123 M1K probably null Het
Tmod4 A T 3: 95,125,618 T22S probably benign Het
Triml1 T C 8: 43,140,718 I149M probably benign Het
Vmn2r76 T A 7: 86,228,261 R525* probably null Het
Zfp109 A T 7: 24,229,133 W292R probably benign Het
Zfp292 C T 4: 34,811,902 A381T probably damaging Het
Zfp791 C T 8: 85,113,506 probably null Het
Other mutations in Vmn2r108
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00903:Vmn2r108 APN 17 20462512 missense probably damaging 0.98
IGL01143:Vmn2r108 APN 17 20462465 missense possibly damaging 0.82
IGL01311:Vmn2r108 APN 17 20462677 nonsense probably null
IGL01411:Vmn2r108 APN 17 20471020 missense probably benign 0.01
IGL01414:Vmn2r108 APN 17 20471680 missense probably benign 0.00
IGL01536:Vmn2r108 APN 17 20463281 missense probably damaging 1.00
IGL01748:Vmn2r108 APN 17 20463214 missense probably benign 0.03
IGL01769:Vmn2r108 APN 17 20471018 missense probably benign 0.02
IGL02022:Vmn2r108 APN 17 20471725 missense possibly damaging 0.77
IGL02041:Vmn2r108 APN 17 20463136 missense probably damaging 1.00
IGL02049:Vmn2r108 APN 17 20471346 missense probably benign 0.00
IGL02344:Vmn2r108 APN 17 20469143 missense probably damaging 1.00
IGL02939:Vmn2r108 APN 17 20471283 missense probably benign 0.05
IGL03202:Vmn2r108 APN 17 20471057 nonsense probably null
PIT4498001:Vmn2r108 UTSW 17 20463017 missense probably damaging 1.00
R0112:Vmn2r108 UTSW 17 20471635 missense probably benign 0.07
R0505:Vmn2r108 UTSW 17 20462834 missense possibly damaging 0.77
R0833:Vmn2r108 UTSW 17 20471459 missense probably benign
R0836:Vmn2r108 UTSW 17 20471459 missense probably benign
R0943:Vmn2r108 UTSW 17 20471135 nonsense probably null
R1411:Vmn2r108 UTSW 17 20462845 missense probably damaging 0.98
R1442:Vmn2r108 UTSW 17 20472361 nonsense probably null
R1587:Vmn2r108 UTSW 17 20472121 missense probably damaging 1.00
R1751:Vmn2r108 UTSW 17 20462524 missense probably damaging 1.00
R1773:Vmn2r108 UTSW 17 20469073 missense probably damaging 1.00
R2021:Vmn2r108 UTSW 17 20470990 missense probably benign 0.00
R2159:Vmn2r108 UTSW 17 20469101 missense probably benign 0.41
R2224:Vmn2r108 UTSW 17 20481033 nonsense probably null
R2226:Vmn2r108 UTSW 17 20481033 nonsense probably null
R2517:Vmn2r108 UTSW 17 20472315 missense probably damaging 1.00
R3710:Vmn2r108 UTSW 17 20462670 missense probably benign
R4470:Vmn2r108 UTSW 17 20462728 missense probably damaging 1.00
R4686:Vmn2r108 UTSW 17 20471374 missense probably damaging 0.99
R4729:Vmn2r108 UTSW 17 20472370 missense probably damaging 0.99
R4799:Vmn2r108 UTSW 17 20462629 missense probably damaging 1.00
R4993:Vmn2r108 UTSW 17 20481187 missense probably benign 0.04
R5088:Vmn2r108 UTSW 17 20470192 missense possibly damaging 0.46
R5213:Vmn2r108 UTSW 17 20471493 missense probably benign 0.00
R5289:Vmn2r108 UTSW 17 20471604 missense probably damaging 1.00
R5290:Vmn2r108 UTSW 17 20471403 missense probably benign 0.00
R5713:Vmn2r108 UTSW 17 20471028 missense probably damaging 1.00
R5753:Vmn2r108 UTSW 17 20462917 missense probably damaging 0.99
R5792:Vmn2r108 UTSW 17 20463136 missense probably damaging 0.99
R5798:Vmn2r108 UTSW 17 20472283 missense probably benign 0.39
R5897:Vmn2r108 UTSW 17 20471318 missense probably benign 0.01
R6018:Vmn2r108 UTSW 17 20463006 missense possibly damaging 0.83
R6156:Vmn2r108 UTSW 17 20472185 missense probably benign 0.03
R6199:Vmn2r108 UTSW 17 20462382 missense probably benign 0.01
R6259:Vmn2r108 UTSW 17 20463109 missense possibly damaging 0.95
R6309:Vmn2r108 UTSW 17 20471398 missense probably damaging 0.98
R6324:Vmn2r108 UTSW 17 20471715 nonsense probably null
R6364:Vmn2r108 UTSW 17 20470998 missense probably benign 0.00
R6446:Vmn2r108 UTSW 17 20472347 nonsense probably null
R6541:Vmn2r108 UTSW 17 20481218 missense probably benign 0.02
R7025:Vmn2r108 UTSW 17 20471083 missense possibly damaging 0.67
R7063:Vmn2r108 UTSW 17 20481148 missense probably damaging 1.00
R7092:Vmn2r108 UTSW 17 20481076 missense probably benign 0.10
R7096:Vmn2r108 UTSW 17 20462500 missense probably damaging 1.00
R7203:Vmn2r108 UTSW 17 20462776 missense probably benign 0.12
R7458:Vmn2r108 UTSW 17 20472270 missense probably benign 0.17
R7619:Vmn2r108 UTSW 17 20472195 missense probably benign 0.02
X0022:Vmn2r108 UTSW 17 20471109 missense probably damaging 1.00
Z1088:Vmn2r108 UTSW 17 20471113 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTCAGACCTTATGGCCTAACC -3'
(R):5'- CATGGTCACAGAAATATAACCTGAGC -3'

Sequencing Primer
(F):5'- TGGCCTAACCAGAATAGCTAATAAG -3'
(R):5'- CCTGAGCATATATTTACTTGACACTC -3'
Posted On2017-08-16