Incidental Mutation 'R6090:Chml'
ID486125
Institutional Source Beutler Lab
Gene Symbol Chml
Ensembl Gene ENSMUSG00000078185
Gene Namechoroideremia-like
SynonymsE030003F13Rik, Rep2
MMRRC Submission 044247-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R6090 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location175682237-175692901 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 175687058 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 432 (Y432*)
Ref Sequence ENSEMBL: ENSMUSP00000147889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027809] [ENSMUST00000104984] [ENSMUST00000209720] [ENSMUST00000210367] [ENSMUST00000211207] [ENSMUST00000211489]
Predicted Effect probably benign
Transcript: ENSMUST00000027809
SMART Domains Protein: ENSMUSP00000027809
Gene: ENSMUSG00000026525

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
Pfam:7tm_1 56 307 4.7e-36 PFAM
low complexity region 314 331 N/A INTRINSIC
low complexity region 363 375 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000104984
AA Change: Y432*
SMART Domains Protein: ENSMUSP00000100600
Gene: ENSMUSG00000078185
AA Change: Y432*

DomainStartEndE-ValueType
Pfam:GDI 5 106 3.1e-14 PFAM
Pfam:GDI 200 534 1e-49 PFAM
low complexity region 598 618 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209720
Predicted Effect probably null
Transcript: ENSMUST00000210367
AA Change: Y89*
Predicted Effect probably null
Transcript: ENSMUST00000211207
AA Change: Y432*
Predicted Effect probably benign
Transcript: ENSMUST00000211489
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of the CHML gene supports geranylgeranylation of most Rab proteins and may substitute for REP-1 in tissues other than retina. CHML is localized close to the gene for Usher syndrome type II. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C T 6: 121,648,013 A450V probably benign Het
Abca8a T C 11: 110,063,222 probably null Het
Adgrl3 A T 5: 81,512,326 N246I probably damaging Het
Arntl2 T A 6: 146,829,696 S500T possibly damaging Het
Cdipt A T 7: 126,976,959 M29L possibly damaging Het
Clasp2 G T 9: 113,852,735 V320L probably benign Het
Col12a1 G A 9: 79,692,393 T826M probably damaging Het
Cpsf3 A G 12: 21,295,193 I169V probably damaging Het
Dhx36 G A 3: 62,496,820 T234M probably damaging Het
Dhx57 A G 17: 80,263,946 probably null Het
Dnah1 A T 14: 31,269,425 I3132N possibly damaging Het
Fbxw20 G T 9: 109,223,363 Q231K probably benign Het
Gfod1 G T 13: 43,200,961 Y179* probably null Het
Glg1 T A 8: 111,181,035 I510F probably damaging Het
Gm10801 TC TCGGC 2: 98,663,806 probably benign Het
Gse1 C A 8: 120,571,169 probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Klrd1 T C 6: 129,595,536 L97P probably damaging Het
Lgmn A T 12: 102,400,154 M240K probably damaging Het
Lrp1b A G 2: 41,185,868 probably null Het
Notch2 A T 3: 98,135,377 R1353* probably null Het
Olfr141 A C 2: 86,806,357 V214G possibly damaging Het
Olfr715b A G 7: 107,106,249 V204A possibly damaging Het
Pcdhb14 G A 18: 37,448,606 S255N probably benign Het
Pcgf2 C T 11: 97,690,991 M25I possibly damaging Het
Poll G T 19: 45,555,997 D328E probably benign Het
Pomgnt2 A T 9: 121,982,797 L306Q probably damaging Het
Proser1 A T 3: 53,478,667 M657L probably benign Het
Rbm47 G C 5: 66,026,283 R326G probably damaging Het
Rdh11 G T 12: 79,189,064 P37T probably benign Het
Rsph10b A T 5: 143,977,128 I286L probably benign Het
Sept4 G A 11: 87,589,517 R238K possibly damaging Het
Sptan1 C T 2: 29,993,887 R580C probably damaging Het
Stard9 T A 2: 120,693,654 W777R probably damaging Het
Timd2 T C 11: 46,687,236 T23A probably benign Het
Tmc4 A G 7: 3,671,053 Y376H probably damaging Het
Tmem143 A G 7: 45,909,526 I297M probably benign Het
Togaram1 A G 12: 64,967,801 T609A probably benign Het
Tyw3 T C 3: 154,597,067 H10R probably benign Het
Unc13b C A 4: 43,239,306 H3456Q probably damaging Het
Zfp131 A T 13: 119,775,996 H275Q probably damaging Het
Other mutations in Chml
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01576:Chml APN 1 175687705 missense probably benign 0.04
IGL01959:Chml APN 1 175687600 missense probably benign 0.30
IGL01981:Chml APN 1 175688185 missense probably damaging 0.98
IGL02321:Chml APN 1 175692334 missense possibly damaging 0.73
IGL03206:Chml APN 1 175687737 missense probably benign 0.00
R0323:Chml UTSW 1 175687084 missense probably benign 0.23
R0504:Chml UTSW 1 175687182 missense probably damaging 1.00
R0665:Chml UTSW 1 175687895 missense probably benign 0.01
R1770:Chml UTSW 1 175687878 missense probably benign 0.00
R1936:Chml UTSW 1 175687259 nonsense probably null
R3864:Chml UTSW 1 175688244 missense probably damaging 1.00
R4213:Chml UTSW 1 175686695 missense probably damaging 1.00
R4271:Chml UTSW 1 175687794 missense probably benign 0.16
R4576:Chml UTSW 1 175686940 missense probably damaging 0.97
R4609:Chml UTSW 1 175687157 nonsense probably null
R4649:Chml UTSW 1 175687396 missense probably benign 0.04
R4922:Chml UTSW 1 175687146 missense possibly damaging 0.89
R6007:Chml UTSW 1 175688028 missense probably benign 0.00
R6287:Chml UTSW 1 175687003 missense probably benign 0.01
R6558:Chml UTSW 1 175687182 missense probably damaging 1.00
R6944:Chml UTSW 1 175688161 missense probably damaging 0.99
R7555:Chml UTSW 1 175687890 missense probably benign 0.00
R7871:Chml UTSW 1 175687400 frame shift probably null
R8459:Chml UTSW 1 175688031 missense probably benign 0.01
X0013:Chml UTSW 1 175687116 missense probably benign 0.06
Z1176:Chml UTSW 1 175687762 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TCAGGTGGACCAGATAGCTG -3'
(R):5'- TTTCCTTTATACGGCCACGGAG -3'

Sequencing Primer
(F):5'- GGACCAGATAGCTGTCCTTCATG -3'
(R):5'- GAGAAATTCCCCAGTGTTTCTGCAG -3'
Posted On2017-08-16