Incidental Mutation 'R6133:Or8b36'
ID 487241
Institutional Source Beutler Lab
Gene Symbol Or8b36
Ensembl Gene ENSMUSG00000094461
Gene Name olfactory receptor family 8 subfamily B member 36
Synonyms MOR162-6, Olfr883, GA_x6K02T2PVTD-31705144-31706073
MMRRC Submission 044280-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.106) question?
Stock # R6133 (G1)
Quality Score 217.468
Status Validated
Chromosome 9
Chromosomal Location 37937104-37938033 bp(+) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) ATTGCTGTTT to ATTGCTGTTTGCTGTTT at 37937836 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000072741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072974]
AlphaFold Q8VF64
Predicted Effect probably null
Transcript: ENSMUST00000072974
SMART Domains Protein: ENSMUSP00000072741
Gene: ENSMUSG00000094461

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 1.6e-48 PFAM
Pfam:7tm_1 41 288 3.7e-24 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 A G 8: 89,052,067 (GRCm39) T912A possibly damaging Het
Akap12 G T 10: 4,305,178 (GRCm39) G663C probably benign Het
Ankhd1 T C 18: 36,758,179 (GRCm39) S958P possibly damaging Het
Cmtm2a T C 8: 105,019,362 (GRCm39) I76V probably benign Het
Cpxm2 G A 7: 131,730,182 (GRCm39) P146S probably damaging Het
Cubn A G 2: 13,313,429 (GRCm39) V3047A probably benign Het
Dgkd T A 1: 87,865,962 (GRCm39) V198E possibly damaging Het
Dnah3 A T 7: 119,685,469 (GRCm39) M181K probably benign Het
Dnah7a T C 1: 53,458,814 (GRCm39) T3775A probably benign Het
Dsg2 A G 18: 20,723,146 (GRCm39) I391V probably benign Het
Ebi3 T A 17: 56,261,311 (GRCm39) V69E probably benign Het
Fn1 T C 1: 71,636,886 (GRCm39) T1998A probably damaging Het
Frmpd1 T A 4: 45,284,915 (GRCm39) H1245Q probably benign Het
Gm7145 T A 1: 117,913,618 (GRCm39) C167S probably damaging Het
Hydin C T 8: 111,327,908 (GRCm39) T4805I probably benign Het
Itgb4 C T 11: 115,874,983 (GRCm39) R447W probably benign Het
Kcnma1 C T 14: 24,053,936 (GRCm39) M21I probably damaging Het
Lrfn5 A G 12: 61,890,574 (GRCm39) D621G probably benign Het
Lrrc15 C T 16: 30,093,054 (GRCm39) G95D probably benign Het
Mex3d A G 10: 80,222,620 (GRCm39) L212P probably damaging Het
Mmel1 C T 4: 154,979,475 (GRCm39) H728Y probably damaging Het
Naip1 A G 13: 100,581,151 (GRCm39) V32A probably benign Het
Nsl1 T C 1: 190,803,403 (GRCm39) L158P probably damaging Het
Or51q1c A T 7: 103,652,532 (GRCm39) T17S possibly damaging Het
Or6c202 G A 10: 128,996,752 (GRCm39) L34F possibly damaging Het
Pakap C T 4: 57,855,516 (GRCm39) Q525* probably null Het
Pcdh15 A T 10: 74,481,805 (GRCm39) probably null Het
Pramel15 T C 4: 144,104,347 (GRCm39) R53G possibly damaging Het
Ptpn1 T C 2: 167,809,716 (GRCm39) V108A possibly damaging Het
Rad9b T C 5: 122,477,831 (GRCm39) N182D possibly damaging Het
Rp1l1 C T 14: 64,267,545 (GRCm39) P1044S probably damaging Het
Scn2a G A 2: 65,573,448 (GRCm39) V1433I probably benign Het
Ssrp1 T G 2: 84,875,683 (GRCm39) probably benign Het
Suco T A 1: 161,662,752 (GRCm39) K560* probably null Het
Tbx3 T C 5: 119,819,018 (GRCm39) V531A probably benign Het
Tmem30c T C 16: 57,098,100 (GRCm39) Y107C probably damaging Het
Topbp1 T A 9: 103,188,963 (GRCm39) probably null Het
Trpm5 A T 7: 142,642,688 (GRCm39) D86E probably damaging Het
Urb2 C T 8: 124,755,300 (GRCm39) Q336* probably null Het
Vmn2r43 A G 7: 8,247,970 (GRCm39) F731S probably damaging Het
Xkr9 A G 1: 13,754,359 (GRCm39) T118A probably benign Het
Zcchc2 A C 1: 105,947,609 (GRCm39) K117N probably damaging Het
Zfp52 T C 17: 21,780,733 (GRCm39) Y194H probably damaging Het
Zfp763 C T 17: 33,237,675 (GRCm39) C490Y possibly damaging Het
Zmynd19 G T 2: 24,848,131 (GRCm39) R148L possibly damaging Het
Other mutations in Or8b36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Or8b36 APN 9 37,937,107 (GRCm39) missense probably benign 0.02
IGL02092:Or8b36 APN 9 37,937,917 (GRCm39) missense possibly damaging 0.80
IGL02351:Or8b36 APN 9 37,937,332 (GRCm39) missense possibly damaging 0.78
IGL02358:Or8b36 APN 9 37,937,332 (GRCm39) missense possibly damaging 0.78
IGL02807:Or8b36 APN 9 37,937,485 (GRCm39) missense probably damaging 1.00
R0972:Or8b36 UTSW 9 37,937,856 (GRCm39) missense possibly damaging 0.88
R1016:Or8b36 UTSW 9 37,937,987 (GRCm39) missense probably damaging 0.98
R1818:Or8b36 UTSW 9 37,937,803 (GRCm39) missense probably damaging 1.00
R4466:Or8b36 UTSW 9 37,937,479 (GRCm39) missense probably damaging 0.99
R4871:Or8b36 UTSW 9 37,937,822 (GRCm39) missense probably damaging 1.00
R5977:Or8b36 UTSW 9 37,937,836 (GRCm39) frame shift probably null
R5979:Or8b36 UTSW 9 37,937,836 (GRCm39) frame shift probably null
R6026:Or8b36 UTSW 9 37,937,836 (GRCm39) frame shift probably null
R6027:Or8b36 UTSW 9 37,937,836 (GRCm39) frame shift probably null
R6029:Or8b36 UTSW 9 37,937,836 (GRCm39) frame shift probably null
R6035:Or8b36 UTSW 9 37,937,836 (GRCm39) frame shift probably null
R6035:Or8b36 UTSW 9 37,937,836 (GRCm39) frame shift probably null
R6053:Or8b36 UTSW 9 37,937,837 (GRCm39) frame shift probably null
R6092:Or8b36 UTSW 9 37,937,836 (GRCm39) frame shift probably null
R6106:Or8b36 UTSW 9 37,937,762 (GRCm39) missense probably damaging 1.00
R6131:Or8b36 UTSW 9 37,937,836 (GRCm39) frame shift probably null
R6132:Or8b36 UTSW 9 37,937,836 (GRCm39) frame shift probably null
R6134:Or8b36 UTSW 9 37,937,836 (GRCm39) frame shift probably null
R6153:Or8b36 UTSW 9 37,937,836 (GRCm39) frame shift probably null
R6251:Or8b36 UTSW 9 37,937,842 (GRCm39) frame shift probably null
R6251:Or8b36 UTSW 9 37,937,841 (GRCm39) frame shift probably null
R6251:Or8b36 UTSW 9 37,937,833 (GRCm39) frame shift probably null
R6251:Or8b36 UTSW 9 37,937,844 (GRCm39) frame shift probably null
R6300:Or8b36 UTSW 9 37,937,836 (GRCm39) frame shift probably null
R6301:Or8b36 UTSW 9 37,937,836 (GRCm39) frame shift probably null
R6305:Or8b36 UTSW 9 37,937,838 (GRCm39) frame shift probably null
R6305:Or8b36 UTSW 9 37,937,836 (GRCm39) frame shift probably null
R6307:Or8b36 UTSW 9 37,937,836 (GRCm39) frame shift probably null
R6312:Or8b36 UTSW 9 37,937,842 (GRCm39) frame shift probably null
R6312:Or8b36 UTSW 9 37,937,837 (GRCm39) frame shift probably null
R6312:Or8b36 UTSW 9 37,937,836 (GRCm39) frame shift probably null
R6312:Or8b36 UTSW 9 37,937,845 (GRCm39) frame shift probably null
R6312:Or8b36 UTSW 9 37,937,843 (GRCm39) nonsense probably null
R6813:Or8b36 UTSW 9 37,937,129 (GRCm39) missense probably damaging 1.00
R7134:Or8b36 UTSW 9 37,937,795 (GRCm39) missense probably benign 0.00
R7775:Or8b36 UTSW 9 37,937,963 (GRCm39) missense probably damaging 1.00
R7778:Or8b36 UTSW 9 37,937,963 (GRCm39) missense probably damaging 1.00
R7984:Or8b36 UTSW 9 37,937,155 (GRCm39) missense probably damaging 1.00
R8326:Or8b36 UTSW 9 37,938,014 (GRCm39) missense probably benign 0.00
R9154:Or8b36 UTSW 9 37,937,690 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGACCTTCTGTGATGGCAAC -3'
(R):5'- CCTCAGAAGCCATAAGATTTTAGTTCC -3'

Sequencing Primer
(F):5'- ATCACTATGCATGTGACATACTTCC -3'
(R):5'- CCACTTAGGTAAAACTCCTTTTCATC -3'
Posted On 2017-10-10