Incidental Mutation 'R6134:Aoah'
ID 487297
Institutional Source Beutler Lab
Gene Symbol Aoah
Ensembl Gene ENSMUSG00000021322
Gene Name acyloxyacyl hydrolase
Synonyms
MMRRC Submission 044281-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6134 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 20794113-21036617 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 20911123 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 196 (R196W)
Ref Sequence ENSEMBL: ENSMUSP00000021757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021757]
AlphaFold O35298
Predicted Effect probably damaging
Transcript: ENSMUST00000021757
AA Change: R196W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021757
Gene: ENSMUSG00000021322
AA Change: R196W

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SapB 38 113 6.25e-15 SMART
Pfam:Lipase_GDSL 256 542 4.8e-19 PFAM
Meta Mutation Damage Score 0.6164 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 94% (51/54)
MGI Phenotype FUNCTION: This genes encodes an enzyme that catalyzes the hydrolysis of acyloxylacyl-linked fatty acyl chains from bacterial lipopolysaccharides. The encoded protein modulates host inflammatory response to gram-negative bacteria. The proprotein is further cleaved into a large and small chain that interact in a heterodimer. Alternative splicing results in multiple transcript variants for this gene. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous null mice have a reduced ability to deacylate bacterial lipopolysaccharides. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik G A 11: 58,876,793 E39K probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Aktip T A 8: 91,129,760 S30C probably damaging Het
Anxa10 G T 8: 62,077,943 H78N probably damaging Het
Arl4c A T 1: 88,701,430 W79R probably damaging Het
Brd2 A T 17: 34,113,695 D178E probably benign Het
Cacna1e G A 1: 154,701,291 P120L probably damaging Het
Cdh16 A T 8: 104,616,065 M17K probably benign Het
Chit1 A G 1: 134,144,060 T103A possibly damaging Het
Clcn3 T C 8: 60,934,573 Y214C probably damaging Het
Coch T A 12: 51,602,753 D282E probably damaging Het
Col1a2 C A 6: 4,538,035 S1181R unknown Het
Col6a2 T C 10: 76,607,144 D506G probably damaging Het
Crx A T 7: 15,868,107 Y215* probably null Het
Fam160a1 T C 3: 85,673,344 E518G possibly damaging Het
Fasn A T 11: 120,822,186 S58T probably benign Het
Garem1 A T 18: 21,129,824 D644E probably benign Het
Gm4763 G A 7: 24,726,056 A3V probably damaging Het
H2-Q2 A C 17: 35,343,241 T155P probably damaging Het
Insr A T 8: 3,192,572 I49N probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Lnpep A G 17: 17,553,192 M639T probably benign Het
Map3k20 C T 2: 72,410,159 S333F probably damaging Het
Miga2 A G 2: 30,371,217 S175G probably benign Het
Muc3a A T 5: 137,210,122 I191N probably damaging Het
Ncoa2 A G 1: 13,174,371 V701A probably damaging Het
Nid2 T C 14: 19,778,783 V565A probably damaging Het
Nova2 G A 7: 18,957,869 A244T unknown Het
Numbl G C 7: 27,281,314 A574P probably damaging Het
Oas3 A G 5: 120,769,048 V508A unknown Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Pcdhb21 T A 18: 37,514,408 S197T probably benign Het
Pck2 T A 14: 55,543,962 M180K probably damaging Het
Pgr T C 9: 8,900,739 V91A possibly damaging Het
Phtf1 A T 3: 104,004,405 M643L probably damaging Het
Prokr1 T C 6: 87,588,855 T3A possibly damaging Het
Ptgs1 T C 2: 36,251,178 Y546H probably damaging Het
Rasa1 A G 13: 85,226,626 L742P probably benign Het
Rbbp6 T C 7: 122,997,311 probably null Het
Rgs22 A G 15: 36,107,048 L64P probably damaging Het
Rnf213 A T 11: 119,411,470 I407F probably damaging Het
Rp1l1 C T 14: 64,030,096 P1044S probably damaging Het
RP24-388A6.3 A T 5: 16,824,685 D473V probably damaging Het
Scin G A 12: 40,060,579 P690L probably damaging Het
Sept9 T C 11: 117,352,161 L58P probably damaging Het
Slc1a7 A G 4: 108,012,436 E566G probably damaging Het
Speer4f1 G A 5: 17,476,142 R6Q probably benign Het
Tnxb A T 17: 34,672,012 Y443F probably damaging Het
Trpv1 A G 11: 73,244,317 I79V probably benign Het
Ttll6 C T 11: 96,139,742 T245I possibly damaging Het
Vmn2r26 T C 6: 124,061,485 I673T probably damaging Het
Zfp60 T C 7: 27,749,898 F664L probably benign Het
Other mutations in Aoah
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01561:Aoah APN 13 21005094 missense probably damaging 0.97
IGL01561:Aoah APN 13 20905735 splice site probably benign
IGL01717:Aoah APN 13 20999977 missense probably damaging 0.99
IGL01997:Aoah APN 13 20999938 missense probably benign 0.00
IGL02212:Aoah APN 13 21002901 missense probably benign 0.05
IGL02325:Aoah APN 13 20917125 missense probably damaging 0.97
IGL03028:Aoah APN 13 20816582 missense possibly damaging 0.62
IGL03304:Aoah APN 13 20915010 splice site probably benign
IGL03352:Aoah APN 13 21000043 missense probably benign 0.01
H8562:Aoah UTSW 13 20816524 missense probably damaging 1.00
PIT4402001:Aoah UTSW 13 20794510 missense probably benign 0.00
R0255:Aoah UTSW 13 20979540 nonsense probably null
R0432:Aoah UTSW 13 20911198 splice site probably benign
R0501:Aoah UTSW 13 21005073 missense probably benign 0.16
R1036:Aoah UTSW 13 20840169 splice site probably benign
R1119:Aoah UTSW 13 20914938 splice site probably benign
R1203:Aoah UTSW 13 20816594 missense probably damaging 1.00
R1589:Aoah UTSW 13 21002948 missense probably damaging 0.99
R1662:Aoah UTSW 13 21000113 splice site probably null
R1907:Aoah UTSW 13 20910094 missense probably damaging 1.00
R1959:Aoah UTSW 13 20794394 start codon destroyed probably null 0.89
R2145:Aoah UTSW 13 20840096 missense probably damaging 1.00
R2237:Aoah UTSW 13 20794311 start gained probably benign
R3438:Aoah UTSW 13 20917072 missense probably benign 0.00
R4226:Aoah UTSW 13 20979526 missense possibly damaging 0.50
R4868:Aoah UTSW 13 20914981 nonsense probably null
R5026:Aoah UTSW 13 20914959 missense probably damaging 1.00
R5139:Aoah UTSW 13 21023237 missense possibly damaging 0.61
R5624:Aoah UTSW 13 20995479 missense probably damaging 1.00
R5853:Aoah UTSW 13 20999902 missense probably benign 0.01
R6459:Aoah UTSW 13 20999942 missense probably damaging 0.99
R7077:Aoah UTSW 13 20910106 missense probably damaging 1.00
R7103:Aoah UTSW 13 21023315 missense probably damaging 1.00
R8198:Aoah UTSW 13 20917120 missense probably damaging 1.00
R8340:Aoah UTSW 13 20999942 missense probably damaging 0.99
R8723:Aoah UTSW 13 21000010 missense possibly damaging 0.81
R8790:Aoah UTSW 13 20851670 missense probably benign 0.16
R8811:Aoah UTSW 13 20999951 missense probably damaging 1.00
R8873:Aoah UTSW 13 20905682 missense probably benign 0.00
R8973:Aoah UTSW 13 20840155 missense probably benign 0.00
R9287:Aoah UTSW 13 21002709 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGTGTCATATTTTCCCTCACATGG -3'
(R):5'- GCCTAATGTTACCTGGTGTGC -3'

Sequencing Primer
(F):5'- CATATTTTCCCTCACATGGCTTATC -3'
(R):5'- ACCTGGTGTGCTTTGCAAGTATC -3'
Posted On 2017-10-10