Mutagenetix > Incidental Mutations

Incidental Mutation 'R6134:Garem1'

487307

Institutional Source

Beutler Lab

Gene Symbol

Garem1

Ensembl Gene

ENSMUSG00000042680

Gene Name

GRB2 associated regulator of MAPK1 subtype 1

Synonyms

Garem, Fam59a, LOC381126

MMRRC Submission

044281-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.151) question?

Stock #

R6134 (G1)

Quality Score

204.009

Status

Validated

Chromosome

Chromosomal Location

21127201-21300138 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 21129824 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 644 (D644E)

Ref Sequence

ENSEMBL: ENSMUSP00000048914 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049260]

AlphaFold

Q3UFT3

Predicted Effect

probably benign
Transcript: ENSMUST00000049260
AA Change: D644E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000048914
Gene: ENSMUSG00000042680
AA Change: D644E

Domain	Start	End	E-Value	Type
Pfam:CABIT	32	318	3.4e-79	PFAM
low complexity region	484	499	N/A	INTRINSIC
low complexity region	512	518	N/A	INTRINSIC
PDB:2DKZ\|A	795	874	2e-40	PDB
Blast:SAM	808	875	2e-36	BLAST
SCOP:d1kw4a_	812	873	4e-4	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.6%

Validation Efficiency

94% (51/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adaptor protein which functions in the epidermal growth factor (EGF) receptor-mediated signaling pathway. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810021J22Rik	G	A	11: 58,876,793	E39K	probably damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Aktip	T	A	8: 91,129,760	S30C	probably damaging	Het
Anxa10	G	T	8: 62,077,943	H78N	probably damaging	Het
Aoah	C	T	13: 20,911,123	R196W	probably damaging	Het
Arl4c	A	T	1: 88,701,430	W79R	probably damaging	Het
Brd2	A	T	17: 34,113,695	D178E	probably benign	Het
Cacna1e	G	A	1: 154,701,291	P120L	probably damaging	Het
Cdh16	A	T	8: 104,616,065	M17K	probably benign	Het
Chit1	A	G	1: 134,144,060	T103A	possibly damaging	Het
Clcn3	T	C	8: 60,934,573	Y214C	probably damaging	Het
Coch	T	A	12: 51,602,753	D282E	probably damaging	Het
Col1a2	C	A	6: 4,538,035	S1181R	unknown	Het
Col6a2	T	C	10: 76,607,144	D506G	probably damaging	Het
Crx	A	T	7: 15,868,107	Y215*	probably null	Het
Fam160a1	T	C	3: 85,673,344	E518G	possibly damaging	Het
Fasn	A	T	11: 120,822,186	S58T	probably benign	Het
Gm4763	G	A	7: 24,726,056	A3V	probably damaging	Het
H2-Q2	A	C	17: 35,343,241	T155P	probably damaging	Het
Insr	A	T	8: 3,192,572	I49N	probably damaging	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Lnpep	A	G	17: 17,553,192	M639T	probably benign	Het
Map3k20	C	T	2: 72,410,159	S333F	probably damaging	Het
Miga2	A	G	2: 30,371,217	S175G	probably benign	Het
Muc3a	A	T	5: 137,210,122	I191N	probably damaging	Het
Ncoa2	A	G	1: 13,174,371	V701A	probably damaging	Het
Nid2	T	C	14: 19,778,783	V565A	probably damaging	Het
Nova2	G	A	7: 18,957,869	A244T	unknown	Het
Numbl	G	C	7: 27,281,314	A574P	probably damaging	Het
Oas3	A	G	5: 120,769,048	V508A	unknown	Het
Olfr883	ATTGCTGTTT	ATTGCTGTTTGCTGTTT	9: 38,026,540		probably null	Het
Otx1	A	T	11: 21,999,406	L24H	probably damaging	Het
Pcdhb21	T	A	18: 37,514,408	S197T	probably benign	Het
Pck2	T	A	14: 55,543,962	M180K	probably damaging	Het
Pgr	T	C	9: 8,900,739	V91A	possibly damaging	Het
Phtf1	A	T	3: 104,004,405	M643L	probably damaging	Het
Prokr1	T	C	6: 87,588,855	T3A	possibly damaging	Het
Ptgs1	T	C	2: 36,251,178	Y546H	probably damaging	Het
Rasa1	A	G	13: 85,226,626	L742P	probably benign	Het
Rbbp6	T	C	7: 122,997,311		probably null	Het
Rgs22	A	G	15: 36,107,048	L64P	probably damaging	Het
Rnf213	A	T	11: 119,411,470	I407F	probably damaging	Het
Rp1l1	C	T	14: 64,030,096	P1044S	probably damaging	Het
RP24-388A6.3	A	T	5: 16,824,685	D473V	probably damaging	Het
Scin	G	A	12: 40,060,579	P690L	probably damaging	Het
Sept9	T	C	11: 117,352,161	L58P	probably damaging	Het
Slc1a7	A	G	4: 108,012,436	E566G	probably damaging	Het
Speer4f1	G	A	5: 17,476,142	R6Q	probably benign	Het
Tnxb	A	T	17: 34,672,012	Y443F	probably damaging	Het
Trpv1	A	G	11: 73,244,317	I79V	probably benign	Het
Ttll6	C	T	11: 96,139,742	T245I	possibly damaging	Het
Vmn2r26	T	C	6: 124,061,485	I673T	probably damaging	Het
Zfp60	T	C	7: 27,749,898	F664L	probably benign	Het

Other mutations in Garem1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00504:Garem1	APN	18	21148657	missense	probably damaging	1.00
IGL01588:Garem1	APN	18	21129797	missense	probably damaging	0.99
IGL02171:Garem1	APN	18	21129241	missense	probably damaging	0.98
IGL02270:Garem1	APN	18	21148450	missense	probably damaging	1.00
IGL03149:Garem1	APN	18	21131466	missense	probably damaging	1.00
R0136:Garem1	UTSW	18	21129991	missense	probably damaging	0.96
R0285:Garem1	UTSW	18	21129612	missense	probably benign
R0361:Garem1	UTSW	18	21299744	nonsense	probably null
R1068:Garem1	UTSW	18	21168755	missense	probably benign	0.00
R1537:Garem1	UTSW	18	21168874	splice site	probably null
R1726:Garem1	UTSW	18	21148262	missense	probably damaging	0.99
R1826:Garem1	UTSW	18	21129452	missense	probably benign	0.00
R2140:Garem1	UTSW	18	21129374	missense	probably damaging	1.00
R3714:Garem1	UTSW	18	21148890	missense	probably damaging	1.00
R3937:Garem1	UTSW	18	21148806	nonsense	probably null
R4362:Garem1	UTSW	18	21236115	missense	possibly damaging	0.62
R4441:Garem1	UTSW	18	21168750	missense	possibly damaging	0.92
R4747:Garem1	UTSW	18	21129943	missense	probably benign
R4814:Garem1	UTSW	18	21148116	missense	probably damaging	1.00
R4831:Garem1	UTSW	18	21129768	missense	probably benign	0.01
R4838:Garem1	UTSW	18	21147893	missense	probably benign	0.00
R5805:Garem1	UTSW	18	21148435	missense	probably benign	0.04
R5963:Garem1	UTSW	18	21129430	missense	probably benign	0.45
R5982:Garem1	UTSW	18	21148351	missense	possibly damaging	0.64
R6242:Garem1	UTSW	18	21129172	missense	possibly damaging	0.72
R6453:Garem1	UTSW	18	21148739	missense	probably damaging	0.99
R6485:Garem1	UTSW	18	21129837	missense	probably benign	0.00
R6596:Garem1	UTSW	18	21148739	missense	probably damaging	0.99
R6662:Garem1	UTSW	18	21148247	missense	probably benign	0.45
R6883:Garem1	UTSW	18	21129712	missense	probably benign
R6937:Garem1	UTSW	18	21147770	missense	probably benign	0.00
R7027:Garem1	UTSW	18	21129994	missense	probably benign
R7256:Garem1	UTSW	18	21148754	missense	probably damaging	1.00
R7534:Garem1	UTSW	18	21299916	start gained	probably benign
R7620:Garem1	UTSW	18	21129841	missense	probably benign
R7869:Garem1	UTSW	18	21299700	missense	probably damaging	1.00
R7963:Garem1	UTSW	18	21148787	missense	probably damaging	0.98
R8058:Garem1	UTSW	18	21148564	missense	probably damaging	1.00
R8953:Garem1	UTSW	18	21131331	critical splice donor site	probably null
R9273:Garem1	UTSW	18	21148217	missense	probably damaging	0.99
R9411:Garem1	UTSW	18	21236000	critical splice donor site	probably null
R9475:Garem1	UTSW	18	21148313	missense	probably benign	0.00
Z1176:Garem1	UTSW	18	21129792	missense	probably damaging	1.00
Z1176:Garem1	UTSW	18	21148325	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCTGCAAAGGAGTTGTCC -3'
(R):5'- TCAGAGTGATACAAGTCCTCCC -3'

Sequencing Primer
(F):5'- AGTTCTCCAGACAGTAGCTGG -3'
(R):5'- GTGATACAAGTCCTCCCAACAGTG -3'

Posted On

2017-10-10