Incidental Mutation 'R6184:Coro2a'
ID488136
Institutional Source Beutler Lab
Gene Symbol Coro2a
Ensembl Gene ENSMUSG00000028337
Gene Namecoronin, actin binding protein 2A
Synonymscoronin 4, IR10, 9030208C03Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R6184 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location46536937-46602202 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46540504 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 472 (T472A)
Ref Sequence ENSEMBL: ENSMUSP00000103386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030021] [ENSMUST00000046897] [ENSMUST00000102924] [ENSMUST00000107756] [ENSMUST00000107757] [ENSMUST00000184112]
Predicted Effect probably benign
Transcript: ENSMUST00000030021
AA Change: T453A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030021
Gene: ENSMUSG00000028337
AA Change: T453A

DomainStartEndE-ValueType
DUF1899 5 69 3.93e-33 SMART
WD40 68 111 2.04e-5 SMART
WD40 121 161 1.58e-2 SMART
WD40 169 208 2.55e-6 SMART
DUF1900 261 397 9.15e-84 SMART
coiled coil region 488 521 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000046897
SMART Domains Protein: ENSMUSP00000038719
Gene: ENSMUSG00000039853

DomainStartEndE-ValueType
BBOX 17 59 1.84e-8 SMART
low complexity region 115 126 N/A INTRINSIC
PRY 264 316 2.63e-13 SMART
SPRY 317 440 2.48e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102924
SMART Domains Protein: ENSMUSP00000099988
Gene: ENSMUSG00000039853

DomainStartEndE-ValueType
BBOX 17 59 1.84e-8 SMART
low complexity region 115 126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107756
AA Change: T453A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103385
Gene: ENSMUSG00000028337
AA Change: T453A

DomainStartEndE-ValueType
DUF1899 5 69 3.93e-33 SMART
WD40 68 111 2.04e-5 SMART
WD40 121 161 1.58e-2 SMART
WD40 169 208 2.55e-6 SMART
DUF1900 261 397 9.15e-84 SMART
coiled coil region 488 521 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107757
AA Change: T472A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103386
Gene: ENSMUSG00000028337
AA Change: T472A

DomainStartEndE-ValueType
DUF1899 24 88 3.93e-33 SMART
WD40 87 130 2.04e-5 SMART
WD40 140 180 1.58e-2 SMART
WD40 188 227 2.55e-6 SMART
DUF1900 280 416 9.15e-84 SMART
coiled coil region 507 540 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129121
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132432
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135062
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139179
Predicted Effect probably benign
Transcript: ENSMUST00000184112
SMART Domains Protein: ENSMUSP00000138876
Gene: ENSMUSG00000039853

DomainStartEndE-ValueType
BBOX 17 59 1.84e-8 SMART
low complexity region 115 126 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This protein contains 5 WD repeats, and has a structural similarity with actin-binding proteins: the D. discoideum coronin and the human p57 protein, suggesting that this protein may also be an actin-binding protein that regulates cell motility. Alternative splicing of this gene generates 2 transcript variants. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004P03Rik A G 12: 17,007,178 F106S probably benign Het
Adgrv1 A T 13: 81,433,838 F4696I probably benign Het
Ank2 T C 3: 126,962,398 I1073V probably damaging Het
BC048403 T C 10: 121,750,905 L375P probably damaging Het
Card11 A T 5: 140,898,278 D415E probably damaging Het
Clec16a G A 16: 10,572,928 probably null Het
D130043K22Rik T A 13: 24,885,591 F878I probably damaging Het
D5Ertd579e G T 5: 36,629,783 D80E probably damaging Het
Ddrgk1 A T 2: 130,664,561 V2E possibly damaging Het
Disp1 T C 1: 183,086,332 H1508R probably benign Het
Dmtf1 T C 5: 9,126,656 N344S probably benign Het
Eml5 A G 12: 98,863,129 V503A possibly damaging Het
Fat1 A G 8: 44,953,392 H1060R probably benign Het
Fbxw8 C T 5: 118,113,749 R233Q probably damaging Het
Fer1l4 T C 2: 156,048,291 K238R probably damaging Het
Flg T A 3: 93,280,050 S270T probably benign Het
Gm10801 TC TCGCC 2: 98,663,806 probably benign Het
Gm3604 A T 13: 62,371,845 V32D probably damaging Het
Gnl2 T G 4: 125,054,229 probably null Het
Gpr162 A G 6: 124,861,241 S149P probably damaging Het
Il2ra T A 2: 11,647,979 probably benign Het
Kmt5b T A 19: 3,804,499 M254K probably damaging Het
Lrriq3 T C 3: 155,129,402 I258T probably benign Het
Mbnl1 T C 3: 60,615,744 L328S probably damaging Het
Mboat2 A G 12: 24,951,431 D277G possibly damaging Het
Mug2 A G 6: 122,037,046 I364V probably benign Het
Myh7 G A 14: 54,988,858 R442C probably damaging Het
Nin A G 12: 70,043,737 L968P probably damaging Het
Olfr1137 A T 2: 87,711,844 Y21N probably benign Het
Olfr355 T C 2: 36,927,392 T241A probably damaging Het
Olfr968 T G 9: 39,772,620 Y60S probably damaging Het
Per1 C T 11: 69,102,904 P403S probably damaging Het
Ppip5k2 T C 1: 97,734,005 I723V possibly damaging Het
Ptprg A G 14: 12,153,943 T555A probably benign Het
Rgsl1 C T 1: 153,827,448 M187I probably benign Het
Sec31a A G 5: 100,369,594 probably null Het
Sptbn5 C T 2: 120,059,417 probably benign Het
Sry C G Y: 2,662,975 Q228H unknown Het
Stx1b G A 7: 127,807,905 T206I possibly damaging Het
Tsc22d4 T A 5: 137,759,089 M35K probably damaging Het
Zc2hc1c A G 12: 85,296,444 K452E probably damaging Het
Zfp386 A G 12: 116,060,513 N582S possibly damaging Het
Zfp457 A G 13: 67,292,912 V437A possibly damaging Het
Zfp599 T C 9: 22,249,651 Y406C probably benign Het
Zfyve26 G A 12: 79,268,727 S1325F probably damaging Het
Other mutations in Coro2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Coro2a APN 4 46540455 missense probably benign 0.06
IGL03093:Coro2a APN 4 46544158 missense possibly damaging 0.93
R1562:Coro2a UTSW 4 46548917 missense probably benign 0.02
R1862:Coro2a UTSW 4 46548797 missense possibly damaging 0.93
R1931:Coro2a UTSW 4 46539138 makesense probably null
R4385:Coro2a UTSW 4 46541961 missense possibly damaging 0.93
R5171:Coro2a UTSW 4 46542372 intron probably benign
R5243:Coro2a UTSW 4 46545620 missense probably damaging 1.00
R5393:Coro2a UTSW 4 46542255 missense probably damaging 1.00
R5785:Coro2a UTSW 4 46564691 missense probably benign 0.03
R6014:Coro2a UTSW 4 46542261 missense probably damaging 1.00
R6264:Coro2a UTSW 4 46562912 missense probably damaging 1.00
R6601:Coro2a UTSW 4 46543421 nonsense probably null
R6732:Coro2a UTSW 4 46551374 missense probably damaging 0.99
R6760:Coro2a UTSW 4 46540572 missense probably benign
R7499:Coro2a UTSW 4 46539188 missense probably benign 0.01
R7516:Coro2a UTSW 4 46562992 missense probably benign 0.12
R7567:Coro2a UTSW 4 46546674 missense probably damaging 0.99
R7816:Coro2a UTSW 4 46546809 missense probably benign 0.01
RF012:Coro2a UTSW 4 46542336 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCCATGTGGTGACTGAATTC -3'
(R):5'- AGGGCCTATCATGATGTCCC -3'

Sequencing Primer
(F):5'- TTCCCTAAGTGAGTTAAGGCCCAG -3'
(R):5'- ATGATGTCCCTTAGACCCGG -3'
Posted On2017-10-10