Incidental Mutation 'R4304:Lsm14a'
ID500523
Institutional Source Beutler Lab
Gene Symbol Lsm14a
Ensembl Gene ENSMUSG00000066568
Gene NameLSM14A mRNA processing body assembly factor
SynonymsTral, 2700023B17Rik
MMRRC Submission 040865-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.862) question?
Stock #R4304 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location34344646-34393315 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to A at 34357433 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085585] [ENSMUST00000133046] [ENSMUST00000133046] [ENSMUST00000155256] [ENSMUST00000206388]
Predicted Effect probably null
Transcript: ENSMUST00000085585
SMART Domains Protein: ENSMUSP00000082723
Gene: ENSMUSG00000066568

DomainStartEndE-ValueType
LSM14 1 98 1.15e-57 SMART
low complexity region 129 140 N/A INTRINSIC
low complexity region 268 287 N/A INTRINSIC
FDF 289 399 6.14e-35 SMART
low complexity region 403 428 N/A INTRINSIC
low complexity region 434 450 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000133046
SMART Domains Protein: ENSMUSP00000119461
Gene: ENSMUSG00000066568

DomainStartEndE-ValueType
LSM14 1 62 1.33e-12 SMART
low complexity region 93 104 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000133046
SMART Domains Protein: ENSMUSP00000119461
Gene: ENSMUSG00000066568

DomainStartEndE-ValueType
LSM14 1 62 1.33e-12 SMART
low complexity region 93 104 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000155256
SMART Domains Protein: ENSMUSP00000118766
Gene: ENSMUSG00000066568

DomainStartEndE-ValueType
LSM14 1 98 1.15e-57 SMART
low complexity region 129 140 N/A INTRINSIC
low complexity region 209 228 N/A INTRINSIC
Pfam:FDF 230 287 7.5e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205455
Predicted Effect probably benign
Transcript: ENSMUST00000205519
Predicted Effect probably benign
Transcript: ENSMUST00000206388
Predicted Effect probably benign
Transcript: ENSMUST00000206830
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sm-like proteins were identified in a variety of organisms based on sequence homology with the Sm protein family (see SNRPD2; 601061). Sm-like proteins contain the Sm sequence motif, which consists of 2 regions separated by a linker of variable length that folds as a loop. The Sm-like proteins are thought to form a stable heteromer present in tri-snRNP particles, which are important for pre-mRNA splicing.[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C T 6: 149,326,238 Q261* probably null Het
Adam32 A T 8: 24,901,529 M323K probably damaging Het
Arhgap42 A G 9: 9,006,488 S636P probably benign Het
Arhgef5 C T 6: 43,279,498 A1180V probably damaging Het
Cep152 G A 2: 125,563,723 Q1630* probably null Het
Cfap157 G A 2: 32,779,042 R350W probably damaging Het
Csgalnact1 A T 8: 68,372,642 V400D possibly damaging Het
Fig4 T A 10: 41,256,427 D461V probably benign Het
Frmd4a C T 2: 4,333,078 R32C probably benign Het
Gcfc2 G A 6: 81,943,007 R397Q probably damaging Het
Gm20939 A C 17: 94,877,281 Q452H probably benign Het
Gm5592 A T 7: 41,286,262 M63L probably benign Het
Gm7173 C G X: 79,498,029 K469N probably damaging Het
H2-M3 T C 17: 37,272,404 M252T probably benign Het
Map4k4 T C 1: 39,973,972 Y76H possibly damaging Het
Npc1 C T 18: 12,210,527 A470T possibly damaging Het
Oit1 G A 14: 8,349,324 P209S probably damaging Het
Olfr1240 A T 2: 89,440,198 V27D probably damaging Het
Prr27 A G 5: 87,842,907 H126R probably benign Het
Rptn C A 3: 93,396,931 H524N probably benign Het
Slc4a11 A T 2: 130,688,138 M240K probably benign Het
Smg1 T C 7: 118,139,518 I3503V probably benign Het
Snx13 A G 12: 35,122,942 K625E probably benign Het
Stk10 T C 11: 32,610,634 V663A probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tpp1 T A 7: 105,750,309 D84V possibly damaging Het
Vmn1r238 T A 18: 3,123,040 R125* probably null Het
Vmn2r12 A G 5: 109,086,006 L780P probably damaging Het
Wfdc15b A C 2: 164,215,468 M1R probably null Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Other mutations in Lsm14a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01564:Lsm14a APN 7 34389355 intron probably benign
IGL02259:Lsm14a APN 7 34371133 missense probably damaging 1.00
IGL02940:Lsm14a APN 7 34371171 nonsense probably null
baluchistan UTSW 7 34353401 nonsense probably null
beast UTSW 7 34375374 missense probably damaging 1.00
R0234:Lsm14a UTSW 7 34365617 missense probably damaging 1.00
R0234:Lsm14a UTSW 7 34365617 missense probably damaging 1.00
R0826:Lsm14a UTSW 7 34371045 splice site probably benign
R1344:Lsm14a UTSW 7 34353557 missense probably damaging 1.00
R1641:Lsm14a UTSW 7 34351374 missense probably damaging 0.99
R1667:Lsm14a UTSW 7 34365654 missense possibly damaging 0.93
R2135:Lsm14a UTSW 7 34371184 missense probably damaging 1.00
R2331:Lsm14a UTSW 7 34357490 missense probably benign
R3709:Lsm14a UTSW 7 34353779 missense probably damaging 0.99
R3710:Lsm14a UTSW 7 34353779 missense probably damaging 0.99
R4998:Lsm14a UTSW 7 34375374 missense probably damaging 1.00
R5304:Lsm14a UTSW 7 34353729 missense possibly damaging 0.58
R5383:Lsm14a UTSW 7 34389364 missense possibly damaging 0.48
R5639:Lsm14a UTSW 7 34353510 missense probably damaging 1.00
R6370:Lsm14a UTSW 7 34357481 missense probably benign 0.17
R7443:Lsm14a UTSW 7 34353838 missense probably benign
R7559:Lsm14a UTSW 7 34353401 nonsense probably null
R7812:Lsm14a UTSW 7 34388876 intron probably benign
R8115:Lsm14a UTSW 7 34375237 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- ATATGGCATTCAGATCCAGGTAGC -3'
(R):5'- GCTAGCAGGTTGAAGCTGAAC -3'

Sequencing Primer
(F):5'- CATTCAGATCCAGGTAGCTGCTG -3'
(R):5'- CAAATTTGATTCTAAGTGGTGTGTG -3'
Posted On2017-12-01