Incidental Mutation 'R4304:Fig4'
ID 322543
Institutional Source Beutler Lab
Gene Symbol Fig4
Ensembl Gene ENSMUSG00000038417
Gene Name FIG4 phosphoinositide 5-phosphatase
Synonyms A530089I17Rik
MMRRC Submission 040865-MU
Accession Numbers

Ncbi RefSeq: NM_133999.1; MGI:2143585

Is this an essential gene? Possibly essential (E-score: 0.536) question?
Stock # R4304 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 41188172-41303260 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 41256427 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 461 (D461V)
Ref Sequence ENSEMBL: ENSMUSP00000039598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043814]
AlphaFold Q91WF7
Predicted Effect probably benign
Transcript: ENSMUST00000043814
AA Change: D461V

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000039598
Gene: ENSMUSG00000038417
AA Change: D461V

DomainStartEndE-ValueType
Pfam:Syja_N 93 424 1.7e-79 PFAM
Blast:Lactamase_B 533 610 6e-21 BLAST
low complexity region 742 771 N/A INTRINSIC
low complexity region 805 813 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype Strain: 3716838
Lethality: D30-D60
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the SAC domain-containing protein gene family. The SAC domain, approximately 400 amino acids in length and consisting of seven conserved motifs, has been shown to possess phosphoinositide phosphatase activity. The yeast homolog, Sac1p, is involved in the regulation of various phosphoinositides, and affects diverse cellular functions such as actin cytoskeleton organization, Golgi function, and maintenance of vacuole morphology. Membrane-bound phosphoinositides function as signaling molecules and play a key role in vesicle trafficking in eukaryotic cells. Mutations in this gene have been associated with Charcot-Marie-Tooth disease, type 4J. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous allele exhibit premature death, severe tremors, diluted coat color, neurodegeneration, impaired coordination, muscle weakness, small size and reduced spleen. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted(3) Gene trapped(12) Spontaneous(1)

Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C T 6: 149,326,238 Q261* probably null Het
Adam32 A T 8: 24,901,529 M323K probably damaging Het
Arhgap42 A G 9: 9,006,488 S636P probably benign Het
Arhgef5 C T 6: 43,279,498 A1180V probably damaging Het
Cep152 G A 2: 125,563,723 Q1630* probably null Het
Cfap157 G A 2: 32,779,042 R350W probably damaging Het
Csgalnact1 A T 8: 68,372,642 V400D possibly damaging Het
Frmd4a C T 2: 4,333,078 R32C probably benign Het
Gcfc2 G A 6: 81,943,007 R397Q probably damaging Het
Gm20939 A C 17: 94,877,281 Q452H probably benign Het
Gm5592 A T 7: 41,286,262 M63L probably benign Het
Gm7173 C G X: 79,498,029 K469N probably damaging Het
H2-M3 T C 17: 37,272,404 M252T probably benign Het
Lsm14a C A 7: 34,357,433 probably null Het
Map4k4 T C 1: 39,973,972 Y76H possibly damaging Het
Npc1 C T 18: 12,210,527 A470T possibly damaging Het
Oit1 G A 14: 8,349,324 P209S probably damaging Het
Olfr1240 A T 2: 89,440,198 V27D probably damaging Het
Prr27 A G 5: 87,842,907 H126R probably benign Het
Rptn C A 3: 93,396,931 H524N probably benign Het
Slc4a11 A T 2: 130,688,138 M240K probably benign Het
Smg1 T C 7: 118,139,518 I3503V probably benign Het
Snx13 A G 12: 35,122,942 K625E probably benign Het
Stk10 T C 11: 32,610,634 V663A probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tpp1 T A 7: 105,750,309 D84V possibly damaging Het
Vmn1r238 T A 18: 3,123,040 R125* probably null Het
Vmn2r12 A G 5: 109,086,006 L780P probably damaging Het
Wfdc15b A C 2: 164,215,468 M1R probably null Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Other mutations in Fig4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Fig4 APN 10 41251788 missense probably damaging 0.99
IGL01013:Fig4 APN 10 41267786 missense probably benign 0.00
IGL01066:Fig4 APN 10 41285417 splice site probably benign
IGL01501:Fig4 APN 10 41270374 missense probably benign
IGL01503:Fig4 APN 10 41256518 missense probably benign 0.00
IGL01535:Fig4 APN 10 41256494 missense probably benign 0.00
IGL01733:Fig4 APN 10 41277393 missense possibly damaging 0.49
IGL01782:Fig4 APN 10 41270400 missense probably benign 0.18
IGL01866:Fig4 APN 10 41232164 missense possibly damaging 0.77
IGL01934:Fig4 APN 10 41228112 missense probably benign 0.03
IGL01966:Fig4 APN 10 41232102 splice site probably null
IGL02032:Fig4 APN 10 41303006 missense probably benign 0.00
IGL02225:Fig4 APN 10 41256452 missense probably benign
IGL02345:Fig4 APN 10 41267774 missense probably null 1.00
IGL02532:Fig4 APN 10 41285281 splice site probably benign
IGL02686:Fig4 APN 10 41264004 missense probably damaging 0.99
IGL02965:Fig4 APN 10 41285665 missense probably damaging 0.98
P0021:Fig4 UTSW 10 41251825 missense probably damaging 1.00
R0017:Fig4 UTSW 10 41273007 missense possibly damaging 0.94
R0017:Fig4 UTSW 10 41273007 missense possibly damaging 0.94
R0117:Fig4 UTSW 10 41230041 nonsense probably null
R0144:Fig4 UTSW 10 41258049 missense probably damaging 0.99
R0655:Fig4 UTSW 10 41285677 missense probably damaging 1.00
R0701:Fig4 UTSW 10 41240512 nonsense probably null
R0751:Fig4 UTSW 10 41272982 missense probably damaging 1.00
R1540:Fig4 UTSW 10 41188586 missense possibly damaging 0.60
R1586:Fig4 UTSW 10 41265427 missense probably damaging 0.99
R2916:Fig4 UTSW 10 41258075 missense probably damaging 0.98
R3927:Fig4 UTSW 10 41263139 missense probably benign
R4586:Fig4 UTSW 10 41188632 missense probably damaging 1.00
R4678:Fig4 UTSW 10 41272998 missense probably benign 0.27
R4858:Fig4 UTSW 10 41233590 missense probably benign 0.00
R5614:Fig4 UTSW 10 41272985 missense probably damaging 0.98
R5896:Fig4 UTSW 10 41254885 missense possibly damaging 0.67
R6126:Fig4 UTSW 10 41265447 missense probably damaging 0.99
R7056:Fig4 UTSW 10 41220932 missense probably benign 0.09
R7350:Fig4 UTSW 10 41251756 missense probably benign 0.03
R7452:Fig4 UTSW 10 41240637 missense possibly damaging 0.88
R7481:Fig4 UTSW 10 41230005 critical splice donor site probably null
R7610:Fig4 UTSW 10 41253713 missense probably damaging 1.00
R7818:Fig4 UTSW 10 41263166 missense probably damaging 0.98
R7830:Fig4 UTSW 10 41256466 missense probably benign 0.00
R8263:Fig4 UTSW 10 41267715 nonsense probably null
R8319:Fig4 UTSW 10 41263101 missense probably damaging 1.00
R8409:Fig4 UTSW 10 41265431 missense probably benign 0.01
R8435:Fig4 UTSW 10 41285674 missense probably benign
R8474:Fig4 UTSW 10 41232174 missense probably benign 0.30
R9086:Fig4 UTSW 10 41285403 missense possibly damaging 0.50
R9131:Fig4 UTSW 10 41265411 missense possibly damaging 0.95
R9248:Fig4 UTSW 10 41277482 missense probably benign
R9401:Fig4 UTSW 10 41267737 missense probably benign
R9564:Fig4 UTSW 10 41285391 missense probably benign 0.20
R9627:Fig4 UTSW 10 41232182 missense probably benign 0.01
R9649:Fig4 UTSW 10 41267767 missense probably benign 0.00
Z1088:Fig4 UTSW 10 41253731 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTATTTGCCTCCCTCTGC -3'
(R):5'- GATTAAAACAATTAAGTCCCTGAACG -3'

Sequencing Primer
(F):5'- TCTGCTCCCACCCCCAC -3'
(R):5'- ATGTTGTTTGCTCTAGATGGAAAAG -3'
Posted On 2015-06-20