Incidental Mutation 'R6191:Wnk4'
ID502585
Institutional Source Beutler Lab
Gene Symbol Wnk4
Ensembl Gene ENSMUSG00000035112
Gene NameWNK lysine deficient protein kinase 4
Synonyms2010002J11Rik, Prkwnk4
MMRRC Submission 044331-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.487) question?
Stock #R6191 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location101260567-101277409 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101264330 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 356 (Y356H)
Ref Sequence ENSEMBL: ENSMUSP00000131298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042477] [ENSMUST00000100414] [ENSMUST00000103108] [ENSMUST00000128260] [ENSMUST00000139487] [ENSMUST00000147741] [ENSMUST00000170056]
Predicted Effect probably benign
Transcript: ENSMUST00000042477
SMART Domains Protein: ENSMUSP00000042088
Gene: ENSMUSG00000078656

DomainStartEndE-ValueType
Pfam:ESCRT-II 9 147 1.3e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100414
SMART Domains Protein: ENSMUSP00000097981
Gene: ENSMUSG00000078656

DomainStartEndE-ValueType
Pfam:ESCRT-II 9 144 5e-61 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103108
AA Change: Y356H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099397
Gene: ENSMUSG00000035112
AA Change: Y356H

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 64 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
low complexity region 95 105 N/A INTRINSIC
low complexity region 126 155 N/A INTRINSIC
Pfam:Pkinase_Tyr 171 427 4.7e-42 PFAM
Pfam:Pkinase 171 429 9e-55 PFAM
Pfam:OSR1_C 450 486 3e-18 PFAM
low complexity region 503 513 N/A INTRINSIC
low complexity region 516 530 N/A INTRINSIC
low complexity region 544 560 N/A INTRINSIC
low complexity region 627 638 N/A INTRINSIC
low complexity region 660 678 N/A INTRINSIC
low complexity region 757 778 N/A INTRINSIC
low complexity region 793 808 N/A INTRINSIC
low complexity region 841 877 N/A INTRINSIC
low complexity region 882 915 N/A INTRINSIC
low complexity region 921 951 N/A INTRINSIC
low complexity region 1014 1033 N/A INTRINSIC
low complexity region 1093 1112 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128260
SMART Domains Protein: ENSMUSP00000127718
Gene: ENSMUSG00000001240

DomainStartEndE-ValueType
signal peptide 1 44 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139487
SMART Domains Protein: ENSMUSP00000129666
Gene: ENSMUSG00000035112

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 64 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
low complexity region 95 105 N/A INTRINSIC
low complexity region 126 155 N/A INTRINSIC
Pfam:Pkinase_Tyr 171 242 4e-8 PFAM
Pfam:Pkinase 171 252 1.9e-10 PFAM
low complexity region 269 283 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000147741
AA Change: Y356H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131298
Gene: ENSMUSG00000035112
AA Change: Y356H

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 64 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
low complexity region 95 105 N/A INTRINSIC
low complexity region 126 155 N/A INTRINSIC
Pfam:Pkinase 171 394 9.3e-50 PFAM
Pfam:Pkinase_Tyr 171 399 3.7e-38 PFAM
low complexity region 401 413 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156205
Predicted Effect probably benign
Transcript: ENSMUST00000170056
SMART Domains Protein: ENSMUSP00000132123
Gene: ENSMUSG00000035112

DomainStartEndE-ValueType
Pfam:OSR1_C 13 49 8.6e-20 PFAM
low complexity region 66 76 N/A INTRINSIC
low complexity region 79 93 N/A INTRINSIC
low complexity region 107 123 N/A INTRINSIC
Meta Mutation Damage Score 0.4745 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WNK family of serine-threonine protein kinases. The kinase is part of the tight junction complex in kidney cells, and regulates the balance between NaCl reabsorption and K(+) secretion. The kinase regulates the activities of several types of ion channels, cotransporters, and exchangers involved in electrolyte flux in epithelial cells. Mutations in this gene result in pseudohypoaldosteronism type IIB.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a null allele display increased Na+, K+ and Cl- urinary excretion, alkalosis and decreased plasma Cl-, K+, Mg2+ and renin levels. Mice homozygous for a point mutation exhibit acidosis, hypertension, increased circulating potassium levels and decreased potassium excretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik A C 9: 56,002,523 D144E possibly damaging Het
Amigo2 T A 15: 97,245,538 K334N probably benign Het
Ano6 T C 15: 95,948,499 probably null Het
Ap1m2 C A 9: 21,299,305 V343F probably benign Het
Apol6 T C 15: 77,055,898 V307A probably benign Het
Arsi C A 18: 60,912,472 A78E probably damaging Het
B2m A T 2: 122,150,915 N37I possibly damaging Het
C8a T C 4: 104,845,903 K363R probably benign Het
Ccdc117 C A 11: 5,534,242 probably null Het
Ccdc154 C A 17: 25,167,971 Q325K probably damaging Het
Cd300e A T 11: 115,054,533 V145E possibly damaging Het
Col19a1 G T 1: 24,317,393 P673Q probably damaging Het
Csn2 A G 5: 87,696,026 probably null Het
Ctnna1 T C 18: 35,174,355 V135A probably damaging Het
Dnah11 T A 12: 118,190,897 D216V probably benign Het
Dnah12 A G 14: 26,710,257 H410R probably benign Het
Dock2 C T 11: 34,231,652 R1637H possibly damaging Het
Dspp A G 5: 104,177,348 N526D unknown Het
Frem2 T C 3: 53,655,280 H602R probably benign Het
Galc A T 12: 98,252,034 H186Q probably damaging Het
Grina T C 15: 76,249,018 V262A probably damaging Het
Gse1 G A 8: 120,553,803 probably null Het
H2-Oa C A 17: 34,093,868 Q40K probably damaging Het
Hfm1 C A 5: 106,886,553 D763Y possibly damaging Het
Hmcn2 T A 2: 31,458,746 Y4925N probably damaging Het
Hs3st3b1 C A 11: 63,889,203 R366L probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Itpr2 A G 6: 146,328,335 V1221A probably benign Het
K230010J24Rik T C 15: 76,046,369 probably null Het
Kdm6b T C 11: 69,406,758 N285S probably benign Het
Klk1b1 T A 7: 43,970,657 N181K probably damaging Het
Kmt2a C A 9: 44,826,828 probably benign Het
Lama5 T A 2: 180,180,611 T2890S probably damaging Het
Lama5 T C 2: 180,185,959 D2170G probably damaging Het
Lsm2 T A 17: 34,982,155 probably benign Het
Map3k5 G T 10: 20,023,669 C232F probably damaging Het
Mapk9 T G 11: 49,863,556 D45E probably damaging Het
Mpnd T C 17: 56,012,482 V315A possibly damaging Het
Msh2 A G 17: 87,723,472 I926V probably benign Het
Mtcl1 C T 17: 66,343,526 R1345H probably damaging Het
Nbeal2 A G 9: 110,627,990 probably null Het
Neo1 T C 9: 58,889,029 D1205G probably damaging Het
Nhlrc2 A G 19: 56,570,859 S259G probably benign Het
Nkain4 G A 2: 180,936,003 P186L probably damaging Het
Nkain4 G A 2: 180,936,004 P186S probably damaging Het
Nlrp1b T A 11: 71,218,457 R73* probably null Het
Nr5a2 T C 1: 136,890,798 D330G probably damaging Het
Nup54 A G 5: 92,424,294 L299P probably damaging Het
Olfr259 A G 2: 87,107,952 V145A probably damaging Het
Olfr56 T C 11: 49,135,050 L286P probably damaging Het
Pcdhb8 T A 18: 37,356,226 V319E probably benign Het
Pcsk6 T A 7: 65,929,127 D129E probably benign Het
Pld5 G A 1: 175,970,534 T433I probably benign Het
Plin1 A T 7: 79,721,599 L459H probably benign Het
Psd4 T C 2: 24,394,487 V121A probably damaging Het
Pxdn A T 12: 29,982,717 I167F possibly damaging Het
R3hdm2 T C 10: 127,484,515 S569P probably damaging Het
Rfng T A 11: 120,782,690 T202S probably damaging Het
Robo1 T C 16: 72,933,808 S266P probably benign Het
Sema3c G T 5: 17,653,806 V68L probably damaging Het
Slco6c1 C T 1: 97,066,083 R645H possibly damaging Het
Slfn8 A G 11: 83,016,800 Y306H possibly damaging Het
Snap91 T C 9: 86,838,052 D144G probably damaging Het
St7l T G 3: 104,868,033 F75C probably damaging Het
Stard10 A G 7: 101,343,261 I145V probably damaging Het
Tekt3 C T 11: 63,078,173 A242V probably damaging Het
Tex44 A G 1: 86,426,584 probably benign Het
Thg1l T C 11: 45,954,161 Q88R probably benign Het
Trav8n-2 T A 14: 53,346,287 I67N probably damaging Het
Ttn G A 2: 76,847,426 probably benign Het
Ube4a A T 9: 44,949,753 L253* probably null Het
Uggt1 A T 1: 36,162,208 N1150K probably damaging Het
Uhrf1bp1l G T 10: 89,805,318 G784C possibly damaging Het
Ush2a T A 1: 188,263,101 L23* probably null Het
Usp22 T A 11: 61,174,776 N37I probably benign Het
Usp53 T A 3: 122,949,741 K515N probably damaging Het
Vmn2r4 T C 3: 64,415,281 K6E probably benign Het
Vps13d C T 4: 145,149,348 V1530M probably damaging Het
Vwa3b A G 1: 37,114,531 I485V possibly damaging Het
Zcchc2 A G 1: 105,990,170 probably benign Het
Zfp345 A C 2: 150,473,090 Y176D probably benign Het
Zfp598 T C 17: 24,677,876 F238S possibly damaging Het
Zkscan17 T C 11: 59,502,994 D10G probably damaging Het
Zmat4 T G 8: 23,902,067 M13R probably damaging Het
Other mutations in Wnk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Wnk4 APN 11 101268748 missense possibly damaging 0.47
IGL00535:Wnk4 APN 11 101264349 missense probably damaging 1.00
IGL01401:Wnk4 APN 11 101276683 splice site probably benign
IGL01931:Wnk4 APN 11 101268484 missense possibly damaging 0.94
IGL01977:Wnk4 APN 11 101265414 missense probably damaging 1.00
IGL02165:Wnk4 APN 11 101275291 unclassified probably benign
IGL02197:Wnk4 APN 11 101263957 missense probably damaging 1.00
IGL02457:Wnk4 APN 11 101269563 splice site probably benign
IGL02963:Wnk4 APN 11 101276213 unclassified probably benign
Caught_dead UTSW 11 101264330 missense probably damaging 1.00
mortification UTSW 11 101263894 makesense probably null
shame UTSW 11 101262856 missense probably damaging 1.00
R0066:Wnk4 UTSW 11 101265435 missense probably damaging 1.00
R0317:Wnk4 UTSW 11 101268804 missense probably benign 0.01
R0628:Wnk4 UTSW 11 101275023 missense probably benign 0.10
R0630:Wnk4 UTSW 11 101265386 missense probably damaging 1.00
R0710:Wnk4 UTSW 11 101274106 missense probably benign 0.22
R1290:Wnk4 UTSW 11 101276340 unclassified probably benign
R1482:Wnk4 UTSW 11 101269636 missense probably damaging 0.99
R1775:Wnk4 UTSW 11 101276340 unclassified probably benign
R2005:Wnk4 UTSW 11 101263890 missense probably damaging 1.00
R2229:Wnk4 UTSW 11 101275641 unclassified probably benign
R2258:Wnk4 UTSW 11 101275035 missense probably damaging 0.98
R2323:Wnk4 UTSW 11 101268481 missense probably damaging 0.99
R3081:Wnk4 UTSW 11 101276891 splice site probably benign
R3763:Wnk4 UTSW 11 101269288 missense probably benign 0.00
R4196:Wnk4 UTSW 11 101269631 missense probably damaging 1.00
R4447:Wnk4 UTSW 11 101268451 missense possibly damaging 0.65
R4614:Wnk4 UTSW 11 101274111 missense probably benign 0.00
R4751:Wnk4 UTSW 11 101276362 unclassified probably benign
R4948:Wnk4 UTSW 11 101268281 missense probably damaging 1.00
R5067:Wnk4 UTSW 11 101262856 missense probably damaging 1.00
R5073:Wnk4 UTSW 11 101261188 missense probably damaging 1.00
R5107:Wnk4 UTSW 11 101275538 unclassified probably benign
R5181:Wnk4 UTSW 11 101265377 missense probably damaging 0.96
R5205:Wnk4 UTSW 11 101265138 missense possibly damaging 0.89
R5252:Wnk4 UTSW 11 101268748 missense possibly damaging 0.47
R5273:Wnk4 UTSW 11 101263869 missense probably damaging 1.00
R5293:Wnk4 UTSW 11 101275197 unclassified probably benign
R5609:Wnk4 UTSW 11 101275636 unclassified probably benign
R5915:Wnk4 UTSW 11 101263894 makesense probably null
R5931:Wnk4 UTSW 11 101261221 missense probably damaging 0.99
R6126:Wnk4 UTSW 11 101276348 unclassified probably benign
R6164:Wnk4 UTSW 11 101275068 missense possibly damaging 0.56
R6267:Wnk4 UTSW 11 101273998 missense probably damaging 1.00
R6274:Wnk4 UTSW 11 101265431 missense probably damaging 1.00
R6296:Wnk4 UTSW 11 101273998 missense probably damaging 1.00
R7132:Wnk4 UTSW 11 101261200 missense probably benign 0.22
R7251:Wnk4 UTSW 11 101265153 missense possibly damaging 0.70
R7352:Wnk4 UTSW 11 101264418 missense probably damaging 1.00
R7404:Wnk4 UTSW 11 101268492 critical splice donor site probably null
R7624:Wnk4 UTSW 11 101264354 nonsense probably null
R7634:Wnk4 UTSW 11 101262895 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGGGCAAGAGTTGGTCAC -3'
(R):5'- CAGGGCATCTTTCTGTCTGG -3'

Sequencing Primer
(F):5'- TTGGTCACCAACACTCCAG -3'
(R):5'- GCATCTTTCTGTCTGGCCTGG -3'
Posted On2018-02-27