Incidental Mutation 'R7848:Gys2'
ID606728
Institutional Source Beutler Lab
Gene Symbol Gys2
Ensembl Gene ENSMUSG00000030244
Gene Nameglycogen synthase 2
Synonymsglycogen synthase, liver, LGS
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R7848 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location142422613-142473109 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 142446015 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 507 (S507*)
Ref Sequence ENSEMBL: ENSMUSP00000032371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032371]
Predicted Effect probably null
Transcript: ENSMUST00000032371
AA Change: S507*
SMART Domains Protein: ENSMUSP00000032371
Gene: ENSMUSG00000030244
AA Change: S507*

DomainStartEndE-ValueType
Pfam:Glycogen_syn 32 667 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, liver glycogen synthase, catalyzes the rate-limiting step in the synthesis of glycogen - the transfer of a glucose molecule from UDP-glucose to a terminal branch of the glycogen molecule. Mutations in this gene cause glycogen storage disease type 0 (GSD-0) - a rare type of early childhood fasting hypoglycemia with decreased liver glycogen content. [provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for a conditional allele knocked out in the liver results in abnormal glycogen homeostasis, altered glucose homeostasis, decreased exercise endurance, and a phenotype similar to patients with glycogen storage disease 0. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik C T 5: 113,192,141 A2T probably damaging Het
Abca3 G T 17: 24,384,532 G566V probably damaging Het
Aff4 C A 11: 53,404,512 N846K probably benign Het
Aldh1l2 C T 10: 83,499,843 R714Q probably benign Het
BC027072 T C 17: 71,749,193 D1163G probably benign Het
Cbln1 T C 8: 87,471,700 T126A probably damaging Het
Ccdc84 A G 9: 44,413,642 S139P probably damaging Het
Ccdc85a A G 11: 28,396,123 S446P possibly damaging Het
Ccdc87 A G 19: 4,841,508 Q676R probably damaging Het
Col26a1 T C 5: 136,747,053 K349E possibly damaging Het
Col6a5 T C 9: 105,928,186 I1174V unknown Het
Cyth1 TGGGCAA T 11: 118,183,923 probably null Het
Dmxl1 A G 18: 49,840,490 D64G possibly damaging Het
Dnajc15 T C 14: 77,840,203 H114R probably damaging Het
Espl1 T C 15: 102,316,526 F1390S probably damaging Het
F5 T C 1: 164,161,877 I116T possibly damaging Het
Fam120b T C 17: 15,405,774 V463A possibly damaging Het
Fat4 A G 3: 38,887,851 M298V probably benign Het
Fhad1 A T 4: 141,905,602 M1197K probably benign Het
Fn1 T A 1: 71,650,601 I127F probably damaging Het
Frmd4a A G 2: 4,591,917 probably benign Het
Gabpb2 A T 3: 95,190,648 V238E probably damaging Het
Gnpat C A 8: 124,886,891 Q626K possibly damaging Het
Gstm7 A T 3: 107,928,586 probably null Het
Ippk T A 13: 49,443,496 probably null Het
Itga8 T A 2: 12,191,737 N623I probably damaging Het
Kcnb1 A G 2: 167,106,268 F220S probably damaging Het
Kiz T A 2: 146,889,180 S197T probably benign Het
Klhl42 A G 6: 147,108,100 N479S probably damaging Het
Lims2 A G 18: 31,958,248 *60W probably null Het
Lrch4 A G 5: 137,633,854 N124S probably damaging Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Map3k13 T C 16: 21,905,871 V373A probably damaging Het
Mapkapk5 A G 5: 121,545,169 I11T probably benign Het
Mroh2b C T 15: 4,938,379 Q967* probably null Het
Mthfd1l A G 10: 4,083,739 T709A possibly damaging Het
Muc6 T C 7: 141,645,921 T939A possibly damaging Het
Ncam2 C T 16: 81,490,379 H394Y probably benign Het
Ncoa7 A T 10: 30,648,418 N161K possibly damaging Het
Nr2c1 C T 10: 94,190,646 S461L probably benign Het
Nrg3 T C 14: 38,668,283 E323G probably damaging Het
Nufip1 G A 14: 76,114,221 R172H probably damaging Het
Nup210l A G 3: 90,203,905 T1705A probably benign Het
Oaf G A 9: 43,222,780 R215C probably damaging Het
Ogfr T C 2: 180,592,433 L99P probably damaging Het
Olfr1349 T C 7: 6,514,862 D189G probably damaging Het
Olfr644 T A 7: 104,068,095 N312I probably benign Het
Pcdh18 A T 3: 49,755,997 S290T possibly damaging Het
Pklr T G 3: 89,142,978 I378S possibly damaging Het
Rbm12 A T 2: 156,096,216 M712K probably benign Het
Rnase10 T C 14: 51,009,513 V116A possibly damaging Het
Scube3 T C 17: 28,165,595 L621P probably benign Het
Slc35e1 T C 8: 72,492,436 I51V probably benign Het
Smcr8 A G 11: 60,779,924 T633A probably benign Het
St18 T C 1: 6,857,445 probably null Het
Tcrg-V5 G A 13: 19,192,679 V99I probably damaging Het
Tm9sf4 T A 2: 153,202,355 I509N probably damaging Het
Tmcc2 T C 1: 132,360,621 K443E probably damaging Het
Tmem98 T G 11: 80,819,932 V139G probably damaging Het
Ttll1 T C 15: 83,497,372 E232G probably damaging Het
Zfp442 T C 2: 150,411,226 N39D possibly damaging Het
Other mutations in Gys2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Gys2 APN 6 142463290 nonsense probably null
IGL02963:Gys2 APN 6 142449428 critical splice donor site probably null
IGL02997:Gys2 APN 6 142449469 missense probably damaging 1.00
candy_corn UTSW 6 142456333 missense probably benign 0.00
embittered UTSW 6 142454484 missense possibly damaging 0.92
hazelnut UTSW 6 142449455 missense possibly damaging 0.67
R0243:Gys2 UTSW 6 142472668 splice site probably benign
R1124:Gys2 UTSW 6 142446013 missense probably damaging 0.97
R1188:Gys2 UTSW 6 142455183 missense probably damaging 1.00
R1208:Gys2 UTSW 6 142450467 critical splice donor site probably null
R1208:Gys2 UTSW 6 142450467 critical splice donor site probably null
R1235:Gys2 UTSW 6 142430293 missense probably damaging 1.00
R1387:Gys2 UTSW 6 142461283 missense probably benign 0.06
R1758:Gys2 UTSW 6 142472706 missense probably damaging 1.00
R1819:Gys2 UTSW 6 142461186 missense probably damaging 1.00
R2221:Gys2 UTSW 6 142456422 missense probably damaging 1.00
R2311:Gys2 UTSW 6 142463244 missense possibly damaging 0.81
R2344:Gys2 UTSW 6 142446022 missense probably damaging 0.99
R3151:Gys2 UTSW 6 142456333 missense probably benign 0.00
R3902:Gys2 UTSW 6 142472800 start codon destroyed probably null 0.98
R4532:Gys2 UTSW 6 142455141 missense probably damaging 0.98
R4577:Gys2 UTSW 6 142454510 missense possibly damaging 0.93
R4588:Gys2 UTSW 6 142449455 missense possibly damaging 0.67
R4606:Gys2 UTSW 6 142454484 missense possibly damaging 0.92
R5338:Gys2 UTSW 6 142454513 missense probably damaging 1.00
R5411:Gys2 UTSW 6 142448421 missense probably damaging 0.99
R6072:Gys2 UTSW 6 142428537 missense probably damaging 0.98
R6261:Gys2 UTSW 6 142459408 missense probably benign
R6366:Gys2 UTSW 6 142463394 missense probably benign 0.02
R6597:Gys2 UTSW 6 142456309 missense probably benign 0.25
R6930:Gys2 UTSW 6 142459380 critical splice donor site probably null
R7033:Gys2 UTSW 6 142472722 missense probably benign 0.08
R7663:Gys2 UTSW 6 142459485 missense probably damaging 1.00
R7757:Gys2 UTSW 6 142454451 missense probably benign 0.10
R7852:Gys2 UTSW 6 142430333 missense probably damaging 1.00
R7931:Gys2 UTSW 6 142446015 nonsense probably null
R7935:Gys2 UTSW 6 142430333 missense probably damaging 1.00
R8008:Gys2 UTSW 6 142454517 missense probably damaging 1.00
R8037:Gys2 UTSW 6 142448393 missense probably benign 0.44
R8070:Gys2 UTSW 6 142448504 critical splice acceptor site probably null
R8152:Gys2 UTSW 6 142427410 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGCAAAGCATTGAATTGACCC -3'
(R):5'- TCTATCCCTGAATGTACAACACAGG -3'

Sequencing Primer
(F):5'- GAATTGACCCAATGAAATGGATCC -3'
(R):5'- CAGAATTCCTGTCCTCCA -3'
Posted On2019-12-20