Incidental Mutation 'R6294:Cacna1b'
ID508583
Institutional Source Beutler Lab
Gene Symbol Cacna1b
Ensembl Gene ENSMUSG00000004113
Gene Namecalcium channel, voltage-dependent, N type, alpha 1B subunit
Synonymsalpha(1B), Cav2.2, Cchn1a
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6294 (G1)
Quality Score198.009
Status Validated
Chromosome2
Chromosomal Location24603887-24763152 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24719057 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 411 (S411T)
Ref Sequence ENSEMBL: ENSMUSP00000100003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041342] [ENSMUST00000070864] [ENSMUST00000100348] [ENSMUST00000102939] [ENSMUST00000114447]
Predicted Effect probably benign
Transcript: ENSMUST00000041342
AA Change: S411T

PolyPhen 2 Score 0.446 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000037416
Gene: ENSMUSG00000004113
AA Change: S411T

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Ion_trans 133 355 1.2e-57 PFAM
PDB:4DEX|B 358 467 8e-66 PDB
Pfam:Ion_trans 516 708 1.1e-47 PFAM
Pfam:PKD_channel 569 715 2.3e-7 PFAM
low complexity region 728 739 N/A INTRINSIC
low complexity region 849 858 N/A INTRINSIC
low complexity region 903 913 N/A INTRINSIC
low complexity region 916 933 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
Pfam:Ion_trans 1174 1408 2.7e-52 PFAM
Pfam:Ion_trans 1498 1698 1.2e-59 PFAM
Pfam:PKD_channel 1551 1705 8.1e-9 PFAM
Ca_chan_IQ 1837 1871 1.09e-11 SMART
low complexity region 2040 2050 N/A INTRINSIC
low complexity region 2092 2114 N/A INTRINSIC
low complexity region 2276 2292 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070864
AA Change: S411T

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000063236
Gene: ENSMUSG00000004113
AA Change: S411T

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Ion_trans 133 355 1.4e-57 PFAM
PDB:4DEX|B 358 467 8e-66 PDB
Pfam:Ion_trans 516 708 1.2e-47 PFAM
Pfam:PKD_channel 569 715 1.5e-7 PFAM
low complexity region 728 739 N/A INTRINSIC
low complexity region 848 857 N/A INTRINSIC
low complexity region 902 912 N/A INTRINSIC
low complexity region 915 932 N/A INTRINSIC
low complexity region 1090 1101 N/A INTRINSIC
Pfam:Ion_trans 1173 1403 1.8e-52 PFAM
Pfam:Ion_trans 1493 1695 5.4e-60 PFAM
Pfam:PKD_channel 1544 1702 4.9e-9 PFAM
Ca_chan_IQ 1798 1832 7.2e-12 SMART
low complexity region 2001 2011 N/A INTRINSIC
low complexity region 2053 2075 N/A INTRINSIC
low complexity region 2237 2253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100348
AA Change: S411T

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000097920
Gene: ENSMUSG00000004113
AA Change: S411T

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Ion_trans 133 355 1.4e-57 PFAM
PDB:4DEX|B 358 468 5e-68 PDB
Pfam:Ion_trans 517 709 1.2e-47 PFAM
Pfam:PKD_channel 570 716 1.6e-7 PFAM
low complexity region 729 740 N/A INTRINSIC
low complexity region 850 859 N/A INTRINSIC
low complexity region 904 914 N/A INTRINSIC
low complexity region 917 934 N/A INTRINSIC
low complexity region 1092 1103 N/A INTRINSIC
Pfam:Ion_trans 1175 1409 3.2e-52 PFAM
Pfam:Ion_trans 1499 1699 1.4e-59 PFAM
Pfam:PKD_channel 1552 1706 5.6e-9 PFAM
Ca_chan_IQ 1838 1872 1.09e-11 SMART
low complexity region 2041 2051 N/A INTRINSIC
low complexity region 2093 2115 N/A INTRINSIC
low complexity region 2277 2293 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102939
AA Change: S411T

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000100003
Gene: ENSMUSG00000004113
AA Change: S411T

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Ion_trans 133 355 1.4e-57 PFAM
PDB:4DEX|B 358 467 1e-65 PDB
Pfam:Ion_trans 516 708 1.2e-47 PFAM
Pfam:PKD_channel 569 715 1.6e-7 PFAM
low complexity region 728 739 N/A INTRINSIC
low complexity region 849 858 N/A INTRINSIC
low complexity region 903 913 N/A INTRINSIC
low complexity region 916 933 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
Pfam:Ion_trans 1174 1404 1.9e-52 PFAM
Pfam:Ion_trans 1494 1696 5.5e-60 PFAM
Pfam:PKD_channel 1545 1703 5e-9 PFAM
Ca_chan_IQ 1835 1869 1.09e-11 SMART
low complexity region 2038 2048 N/A INTRINSIC
low complexity region 2090 2112 N/A INTRINSIC
low complexity region 2274 2290 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114447
AA Change: S411T

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000110090
Gene: ENSMUSG00000004113
AA Change: S411T

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Ion_trans 94 367 8.5e-69 PFAM
Pfam:Ion_trans 482 721 2.4e-57 PFAM
Pfam:PKD_channel 571 715 1e-7 PFAM
low complexity region 729 740 N/A INTRINSIC
low complexity region 850 859 N/A INTRINSIC
low complexity region 904 914 N/A INTRINSIC
low complexity region 917 934 N/A INTRINSIC
low complexity region 1092 1103 N/A INTRINSIC
Pfam:Ion_trans 1139 1421 1.3e-62 PFAM
Pfam:Ion_trans 1464 1711 3.2e-64 PFAM
Pfam:PKD_channel 1550 1706 2.7e-9 PFAM
Pfam:GPHH 1713 1783 1.9e-39 PFAM
Ca_chan_IQ 1838 1872 1.09e-11 SMART
low complexity region 2041 2051 N/A INTRINSIC
low complexity region 2093 2115 N/A INTRINSIC
low complexity region 2277 2293 N/A INTRINSIC
Meta Mutation Damage Score 0.0877 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the pore-forming subunit of an N-type voltage-dependent calcium channel, which controls neurotransmitter release from neurons. The encoded protein forms a complex with alpha-2, beta, and delta subunits to form the high-voltage activated channel. This channel is sensitive to omega-conotoxin-GVIA and omega-agatoxin-IIIA but insensitive to dihydropyridines. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice deficient in this gene exhibit defects in nociception, memory and learning. They also exhibit hyperactive and hyperaggressive behaviors as well as defects in the the sleep-wake cycle. Deficits in the sympathetic nervous system results in defects in circulatory regulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,654,481 H579L probably benign Het
Aldh2 G A 5: 121,572,816 Q8* probably null Het
Ankdd1a G T 9: 65,520,164 H10Q probably benign Het
Arpp21 A G 9: 112,127,452 F453L probably damaging Het
Birc6 C A 17: 74,689,257 D4461E probably benign Het
Camk2g A G 14: 20,764,949 I203T probably damaging Het
Cat A T 2: 103,460,295 C425S probably benign Het
Ccdc34 A G 2: 110,018,151 D95G probably benign Het
Clca4b T C 3: 144,925,185 S305G probably null Het
Cul7 T C 17: 46,663,148 I1453T probably benign Het
Dlg1 T A 16: 31,838,124 I612N probably damaging Het
Dync2h1 T G 9: 7,084,986 K561T probably benign Het
Erbin T C 13: 103,857,056 T359A probably benign Het
Far2 T A 6: 148,157,482 L222Q probably damaging Het
Fbxw17 A G 13: 50,423,803 E114G probably benign Het
Fryl A T 5: 73,191,759 probably benign Het
Ggn A G 7: 29,173,848 D666G possibly damaging Het
Hal G A 10: 93,514,143 probably null Het
Htt A G 5: 34,821,826 D851G probably benign Het
Ighv14-2 A T 12: 113,994,598 D74E probably benign Het
Igkv5-43 G A 6: 69,823,442 S87L probably damaging Het
Klhl29 A T 12: 5,083,995 F720I probably damaging Het
Klk1b8 T A 7: 43,952,772 Y43N probably damaging Het
Krtap6-3 T A 16: 89,084,101 Y7N unknown Het
Lama4 T A 10: 39,075,470 F1070L probably damaging Het
Map4 A G 9: 110,002,746 E98G possibly damaging Het
Mbtd1 C T 11: 93,932,232 H493Y possibly damaging Het
Mki67 A G 7: 135,704,590 M581T probably benign Het
Mtss1l T A 8: 110,727,328 N43K possibly damaging Het
Mylk3 T A 8: 85,350,383 I475F probably damaging Het
Nat14 C T 7: 4,924,074 R82* probably null Het
Nckap1 T C 2: 80,541,514 N324S probably benign Het
Nemp1 C T 10: 127,694,522 T281M possibly damaging Het
Nrg3 A T 14: 38,397,239 H425Q probably benign Het
Olfr101 T A 17: 37,299,553 T290S probably benign Het
Olfr1318 A G 2: 112,156,019 I23V probably benign Het
Olfr1487 T C 19: 13,619,366 V25A probably benign Het
Olfr584 A T 7: 103,085,667 I45F probably benign Het
Olfr622 A G 7: 103,639,591 M183T probably damaging Het
Olfr95 T C 17: 37,211,626 T76A probably benign Het
Omd T A 13: 49,589,991 N172K probably damaging Het
Orc1 T C 4: 108,590,670 I38T probably benign Het
Oxct1 A G 15: 4,142,822 T457A possibly damaging Het
Pcdh17 A T 14: 84,477,668 K924N probably benign Het
Pkhd1l1 A T 15: 44,570,028 I3435F probably damaging Het
Psg20 C A 7: 18,682,679 V171F probably damaging Het
Rab11fip2 A T 19: 59,937,099 S87T probably damaging Het
Rabgap1l T C 1: 160,231,849 T237A probably benign Het
Rasgrp1 A T 2: 117,291,792 Y372* probably null Het
Rell1 G T 5: 63,939,705 probably benign Het
Rps14 A G 18: 60,776,961 K61E possibly damaging Het
Rtl6 A G 15: 84,557,120 V25A possibly damaging Het
Ryr2 G T 13: 11,879,496 S185R probably damaging Het
Slc10a2 C T 8: 5,091,621 probably null Het
Slc14a1 T A 18: 78,110,058 probably null Het
Smad2 A T 18: 76,289,162 N215I probably benign Het
Smchd1 A T 17: 71,370,927 N1473K probably benign Het
Spag9 A G 11: 94,093,485 probably null Het
Stk31 A C 6: 49,417,344 R213S probably benign Het
Tmod4 A T 3: 95,128,306 Q255L probably benign Het
Tnpo1 T A 13: 98,890,774 Y3F probably benign Het
Tom1l1 A C 11: 90,661,761 Y206* probably null Het
Tulp2 A G 7: 45,514,692 K36E probably damaging Het
Tulp4 C T 17: 6,201,819 R282C probably damaging Het
Unc5b A T 10: 60,778,331 N246K possibly damaging Het
Ush2a C G 1: 188,536,370 S1674R possibly damaging Het
Vmn1r224 T C 17: 20,419,821 I220T probably benign Het
Vmn1r7 G C 6: 57,024,419 N285K probably benign Het
Vmn2r83 C T 10: 79,477,854 P99S probably damaging Het
Zbtb38 A G 9: 96,687,229 F601L probably benign Het
Zc3h3 A T 15: 75,809,568 S555T possibly damaging Het
Other mutations in Cacna1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Cacna1b APN 2 24651200 nonsense probably null
IGL00508:Cacna1b APN 2 24657289 critical splice donor site probably null
IGL01085:Cacna1b APN 2 24678994 missense probably damaging 0.98
IGL01310:Cacna1b APN 2 24685782 missense probably damaging 1.00
IGL01361:Cacna1b APN 2 24679095 missense possibly damaging 0.49
IGL01471:Cacna1b APN 2 24657292 missense probably damaging 1.00
IGL01537:Cacna1b APN 2 24658528 missense probably damaging 1.00
IGL01547:Cacna1b APN 2 24632035 unclassified probably benign
IGL01750:Cacna1b APN 2 24654395 missense probably damaging 1.00
IGL01813:Cacna1b APN 2 24609890 missense probably damaging 1.00
IGL01939:Cacna1b APN 2 24661757 missense probably damaging 1.00
IGL01955:Cacna1b APN 2 24639137 missense probably damaging 1.00
IGL01972:Cacna1b APN 2 24635095 critical splice donor site probably null
IGL01987:Cacna1b APN 2 24697567 splice site probably null
IGL02096:Cacna1b APN 2 24678915 missense probably benign 0.01
IGL02111:Cacna1b APN 2 24606991 missense probably damaging 0.96
IGL02254:Cacna1b APN 2 24616815 splice site probably null
IGL03084:Cacna1b APN 2 24609932 missense probably benign
IGL03184:Cacna1b APN 2 24658489 critical splice donor site probably null
IGL03202:Cacna1b APN 2 24651112 missense probably damaging 1.00
IGL03210:Cacna1b APN 2 24650572 missense probably benign 0.00
IGL03402:Cacna1b APN 2 24762809 missense probably damaging 1.00
PIT4283001:Cacna1b UTSW 2 24631941 missense probably damaging 1.00
R0062:Cacna1b UTSW 2 24758331 missense probably damaging 1.00
R0062:Cacna1b UTSW 2 24758331 missense probably damaging 1.00
R0206:Cacna1b UTSW 2 24607480 missense probably damaging 1.00
R0208:Cacna1b UTSW 2 24607480 missense probably damaging 1.00
R0240:Cacna1b UTSW 2 24638657 unclassified probably benign
R0265:Cacna1b UTSW 2 24761844 missense probably damaging 1.00
R0352:Cacna1b UTSW 2 24625232 intron probably benign
R0376:Cacna1b UTSW 2 24659003 splice site probably benign
R0383:Cacna1b UTSW 2 24761844 missense probably damaging 1.00
R0432:Cacna1b UTSW 2 24687704 missense probably damaging 1.00
R0595:Cacna1b UTSW 2 24649989 splice site probably benign
R0660:Cacna1b UTSW 2 24654446 missense probably damaging 1.00
R0664:Cacna1b UTSW 2 24654446 missense probably damaging 1.00
R1107:Cacna1b UTSW 2 24697603 missense probably damaging 1.00
R1184:Cacna1b UTSW 2 24687745 unclassified probably null
R1445:Cacna1b UTSW 2 24718136 splice site probably benign
R1446:Cacna1b UTSW 2 24706177 missense probably benign 0.01
R1496:Cacna1b UTSW 2 24678035 missense probably benign
R1614:Cacna1b UTSW 2 24690807 missense possibly damaging 0.88
R1626:Cacna1b UTSW 2 24606709 missense probably damaging 1.00
R1917:Cacna1b UTSW 2 24616879 missense probably null 0.80
R1984:Cacna1b UTSW 2 24648986 missense probably damaging 1.00
R1986:Cacna1b UTSW 2 24648986 missense probably damaging 1.00
R1989:Cacna1b UTSW 2 24721374 missense probably damaging 1.00
R1990:Cacna1b UTSW 2 24732306 missense probably damaging 1.00
R1991:Cacna1b UTSW 2 24732306 missense probably damaging 1.00
R1992:Cacna1b UTSW 2 24732306 missense probably damaging 1.00
R2098:Cacna1b UTSW 2 24650546 missense probably damaging 1.00
R2139:Cacna1b UTSW 2 24679473 missense probably benign 0.07
R2196:Cacna1b UTSW 2 24761788 missense probably damaging 1.00
R2229:Cacna1b UTSW 2 24685804 missense probably damaging 1.00
R2292:Cacna1b UTSW 2 24606620 missense probably benign 0.01
R2570:Cacna1b UTSW 2 24606637 nonsense probably null
R2850:Cacna1b UTSW 2 24761788 missense probably damaging 1.00
R2911:Cacna1b UTSW 2 24607541 unclassified probably null
R2937:Cacna1b UTSW 2 24606528 missense probably benign 0.00
R2938:Cacna1b UTSW 2 24606528 missense probably benign 0.00
R3522:Cacna1b UTSW 2 24763043 missense possibly damaging 0.94
R3800:Cacna1b UTSW 2 24658959 missense probably benign 0.15
R4166:Cacna1b UTSW 2 24677911 missense probably benign 0.32
R4300:Cacna1b UTSW 2 24635239 missense probably damaging 1.00
R4366:Cacna1b UTSW 2 24702620 missense probably damaging 1.00
R4493:Cacna1b UTSW 2 24652938 missense probably damaging 0.99
R4494:Cacna1b UTSW 2 24652938 missense probably damaging 0.99
R4522:Cacna1b UTSW 2 24654430 missense probably damaging 1.00
R4612:Cacna1b UTSW 2 24626852 nonsense probably null
R4673:Cacna1b UTSW 2 24631944 missense probably damaging 1.00
R4703:Cacna1b UTSW 2 24654463 missense probably damaging 1.00
R4704:Cacna1b UTSW 2 24654463 missense probably damaging 1.00
R4777:Cacna1b UTSW 2 24732325 missense probably damaging 1.00
R4795:Cacna1b UTSW 2 24637487 missense possibly damaging 0.58
R4796:Cacna1b UTSW 2 24637487 missense possibly damaging 0.58
R4962:Cacna1b UTSW 2 24618318 missense probably damaging 1.00
R4962:Cacna1b UTSW 2 24657366 missense probably damaging 1.00
R4974:Cacna1b UTSW 2 24648523 missense probably damaging 0.99
R4990:Cacna1b UTSW 2 24678874 critical splice donor site probably null
R5109:Cacna1b UTSW 2 24690785 missense possibly damaging 0.88
R5117:Cacna1b UTSW 2 24732328 missense probably damaging 1.00
R5176:Cacna1b UTSW 2 24635131 missense probably damaging 1.00
R5253:Cacna1b UTSW 2 24719952 missense probably damaging 1.00
R5372:Cacna1b UTSW 2 24733959 missense probably damaging 1.00
R5374:Cacna1b UTSW 2 24706216 missense probably damaging 1.00
R5465:Cacna1b UTSW 2 24650426 critical splice donor site probably null
R5568:Cacna1b UTSW 2 24607600 missense probably damaging 1.00
R5580:Cacna1b UTSW 2 24650554 missense probably damaging 1.00
R5677:Cacna1b UTSW 2 24679358 missense possibly damaging 0.64
R6277:Cacna1b UTSW 2 24730796 missense probably damaging 1.00
R6609:Cacna1b UTSW 2 24653049 missense probably damaging 1.00
R6929:Cacna1b UTSW 2 24632010 missense probably damaging 1.00
R7016:Cacna1b UTSW 2 24762848 missense possibly damaging 0.77
R7112:Cacna1b UTSW 2 24690761 missense probably damaging 0.97
R7162:Cacna1b UTSW 2 24700022 missense probably benign 0.06
R7401:Cacna1b UTSW 2 24679294 missense probably benign 0.00
R7402:Cacna1b UTSW 2 24607659 missense probably benign 0.21
R7442:Cacna1b UTSW 2 24607501 missense probably benign
R7450:Cacna1b UTSW 2 24635135 nonsense probably null
R7481:Cacna1b UTSW 2 24616862 missense probably damaging 0.99
R7792:Cacna1b UTSW 2 24677965 missense probably damaging 0.99
Z1088:Cacna1b UTSW 2 24661844 missense probably damaging 1.00
Z1088:Cacna1b UTSW 2 24733945 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGGTATGAAACTTCTAGAAGC -3'
(R):5'- TAAAGCAGCTGGGTCTCTGC -3'

Sequencing Primer
(F):5'- GAAACTTCTAGAAGCAACATTGTCC -3'
(R):5'- AGGCATGCAGTCACAGC -3'
Posted On2018-03-15