Mutagenetix > Incidental Mutations

Incidental Mutation 'R6294:Cacna1b'

508583

Institutional Source

Beutler Lab

Gene Symbol

Cacna1b

Ensembl Gene

ENSMUSG00000004113

Gene Name

calcium channel, voltage-dependent, N type, alpha 1B subunit

Synonyms

alpha(1B), Cav2.2, Cchn1a

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6294 (G1)

Quality Score

198.009

Status

Validated

Chromosome

Chromosomal Location

24603887-24763152 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 24719057 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 411 (S411T)

Ref Sequence

ENSEMBL: ENSMUSP00000100003 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041342] [ENSMUST00000070864] [ENSMUST00000100348] [ENSMUST00000102939] [ENSMUST00000114447]

Predicted Effect

probably benign
Transcript: ENSMUST00000041342
AA Change: S411T

PolyPhen 2 Score 0.446 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000037416
Gene: ENSMUSG00000004113
AA Change: S411T

Domain	Start	End	E-Value	Type
low complexity region	9	40	N/A	INTRINSIC
Pfam:Ion_trans	133	355	1.2e-57	PFAM
PDB:4DEX\|B	358	467	8e-66	PDB
Pfam:Ion_trans	516	708	1.1e-47	PFAM
Pfam:PKD_channel	569	715	2.3e-7	PFAM
low complexity region	728	739	N/A	INTRINSIC
low complexity region	849	858	N/A	INTRINSIC
low complexity region	903	913	N/A	INTRINSIC
low complexity region	916	933	N/A	INTRINSIC
low complexity region	1091	1102	N/A	INTRINSIC
Pfam:Ion_trans	1174	1408	2.7e-52	PFAM
Pfam:Ion_trans	1498	1698	1.2e-59	PFAM
Pfam:PKD_channel	1551	1705	8.1e-9	PFAM
Ca_chan_IQ	1837	1871	1.09e-11	SMART
low complexity region	2040	2050	N/A	INTRINSIC
low complexity region	2092	2114	N/A	INTRINSIC
low complexity region	2276	2292	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000070864
AA Change: S411T

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000063236
Gene: ENSMUSG00000004113
AA Change: S411T

Domain	Start	End	E-Value	Type
low complexity region	9	40	N/A	INTRINSIC
Pfam:Ion_trans	133	355	1.4e-57	PFAM
PDB:4DEX\|B	358	467	8e-66	PDB
Pfam:Ion_trans	516	708	1.2e-47	PFAM
Pfam:PKD_channel	569	715	1.5e-7	PFAM
low complexity region	728	739	N/A	INTRINSIC
low complexity region	848	857	N/A	INTRINSIC
low complexity region	902	912	N/A	INTRINSIC
low complexity region	915	932	N/A	INTRINSIC
low complexity region	1090	1101	N/A	INTRINSIC
Pfam:Ion_trans	1173	1403	1.8e-52	PFAM
Pfam:Ion_trans	1493	1695	5.4e-60	PFAM
Pfam:PKD_channel	1544	1702	4.9e-9	PFAM
Ca_chan_IQ	1798	1832	7.2e-12	SMART
low complexity region	2001	2011	N/A	INTRINSIC
low complexity region	2053	2075	N/A	INTRINSIC
low complexity region	2237	2253	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000100348
AA Change: S411T

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000097920
Gene: ENSMUSG00000004113
AA Change: S411T

Domain	Start	End	E-Value	Type
low complexity region	9	40	N/A	INTRINSIC
Pfam:Ion_trans	133	355	1.4e-57	PFAM
PDB:4DEX\|B	358	468	5e-68	PDB
Pfam:Ion_trans	517	709	1.2e-47	PFAM
Pfam:PKD_channel	570	716	1.6e-7	PFAM
low complexity region	729	740	N/A	INTRINSIC
low complexity region	850	859	N/A	INTRINSIC
low complexity region	904	914	N/A	INTRINSIC
low complexity region	917	934	N/A	INTRINSIC
low complexity region	1092	1103	N/A	INTRINSIC
Pfam:Ion_trans	1175	1409	3.2e-52	PFAM
Pfam:Ion_trans	1499	1699	1.4e-59	PFAM
Pfam:PKD_channel	1552	1706	5.6e-9	PFAM
Ca_chan_IQ	1838	1872	1.09e-11	SMART
low complexity region	2041	2051	N/A	INTRINSIC
low complexity region	2093	2115	N/A	INTRINSIC
low complexity region	2277	2293	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102939
AA Change: S411T

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000100003
Gene: ENSMUSG00000004113
AA Change: S411T

Domain	Start	End	E-Value	Type
low complexity region	9	40	N/A	INTRINSIC
Pfam:Ion_trans	133	355	1.4e-57	PFAM
PDB:4DEX\|B	358	467	1e-65	PDB
Pfam:Ion_trans	516	708	1.2e-47	PFAM
Pfam:PKD_channel	569	715	1.6e-7	PFAM
low complexity region	728	739	N/A	INTRINSIC
low complexity region	849	858	N/A	INTRINSIC
low complexity region	903	913	N/A	INTRINSIC
low complexity region	916	933	N/A	INTRINSIC
low complexity region	1091	1102	N/A	INTRINSIC
Pfam:Ion_trans	1174	1404	1.9e-52	PFAM
Pfam:Ion_trans	1494	1696	5.5e-60	PFAM
Pfam:PKD_channel	1545	1703	5e-9	PFAM
Ca_chan_IQ	1835	1869	1.09e-11	SMART
low complexity region	2038	2048	N/A	INTRINSIC
low complexity region	2090	2112	N/A	INTRINSIC
low complexity region	2274	2290	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114447
AA Change: S411T

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000110090
Gene: ENSMUSG00000004113
AA Change: S411T

Domain	Start	End	E-Value	Type
low complexity region	9	40	N/A	INTRINSIC
Pfam:Ion_trans	94	367	8.5e-69	PFAM
Pfam:Ion_trans	482	721	2.4e-57	PFAM
Pfam:PKD_channel	571	715	1e-7	PFAM
low complexity region	729	740	N/A	INTRINSIC
low complexity region	850	859	N/A	INTRINSIC
low complexity region	904	914	N/A	INTRINSIC
low complexity region	917	934	N/A	INTRINSIC
low complexity region	1092	1103	N/A	INTRINSIC
Pfam:Ion_trans	1139	1421	1.3e-62	PFAM
Pfam:Ion_trans	1464	1711	3.2e-64	PFAM
Pfam:PKD_channel	1550	1706	2.7e-9	PFAM
Pfam:GPHH	1713	1783	1.9e-39	PFAM
Ca_chan_IQ	1838	1872	1.09e-11	SMART
low complexity region	2041	2051	N/A	INTRINSIC
low complexity region	2093	2115	N/A	INTRINSIC
low complexity region	2277	2293	N/A	INTRINSIC

Meta Mutation Damage Score

0.0877

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.2%

Validation Efficiency

99% (71/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the pore-forming subunit of an N-type voltage-dependent calcium channel, which controls neurotransmitter release from neurons. The encoded protein forms a complex with alpha-2, beta, and delta subunits to form the high-voltage activated channel. This channel is sensitive to omega-conotoxin-GVIA and omega-agatoxin-IIIA but insensitive to dihydropyridines. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice deficient in this gene exhibit defects in nociception, memory and learning. They also exhibit hyperactive and hyperaggressive behaviors as well as defects in the the sleep-wake cycle. Deficits in the sympathetic nervous system results in defects in circulatory regulation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	A	T	6: 121,654,481	H579L	probably benign	Het
Aldh2	G	A	5: 121,572,816	Q8*	probably null	Het
Ankdd1a	G	T	9: 65,520,164	H10Q	probably benign	Het
Arpp21	A	G	9: 112,127,452	F453L	probably damaging	Het
Birc6	C	A	17: 74,689,257	D4461E	probably benign	Het
Camk2g	A	G	14: 20,764,949	I203T	probably damaging	Het
Cat	A	T	2: 103,460,295	C425S	probably benign	Het
Ccdc34	A	G	2: 110,018,151	D95G	probably benign	Het
Clca4b	T	C	3: 144,925,185	S305G	probably null	Het
Cul7	T	C	17: 46,663,148	I1453T	probably benign	Het
Dlg1	T	A	16: 31,838,124	I612N	probably damaging	Het
Dync2h1	T	G	9: 7,084,986	K561T	probably benign	Het
Erbin	T	C	13: 103,857,056	T359A	probably benign	Het
Far2	T	A	6: 148,157,482	L222Q	probably damaging	Het
Fbxw17	A	G	13: 50,423,803	E114G	probably benign	Het
Fryl	A	T	5: 73,191,759		probably benign	Het
Ggn	A	G	7: 29,173,848	D666G	possibly damaging	Het
Hal	G	A	10: 93,514,143		probably null	Het
Htt	A	G	5: 34,821,826	D851G	probably benign	Het
Ighv14-2	A	T	12: 113,994,598	D74E	probably benign	Het
Igkv5-43	G	A	6: 69,823,442	S87L	probably damaging	Het
Klhl29	A	T	12: 5,083,995	F720I	probably damaging	Het
Klk1b8	T	A	7: 43,952,772	Y43N	probably damaging	Het
Krtap6-3	T	A	16: 89,084,101	Y7N	unknown	Het
Lama4	T	A	10: 39,075,470	F1070L	probably damaging	Het
Map4	A	G	9: 110,002,746	E98G	possibly damaging	Het
Mbtd1	C	T	11: 93,932,232	H493Y	possibly damaging	Het
Mki67	A	G	7: 135,704,590	M581T	probably benign	Het
Mtss1l	T	A	8: 110,727,328	N43K	possibly damaging	Het
Mylk3	T	A	8: 85,350,383	I475F	probably damaging	Het
Nat14	C	T	7: 4,924,074	R82*	probably null	Het
Nckap1	T	C	2: 80,541,514	N324S	probably benign	Het
Nemp1	C	T	10: 127,694,522	T281M	possibly damaging	Het
Nrg3	A	T	14: 38,397,239	H425Q	probably benign	Het
Olfr101	T	A	17: 37,299,553	T290S	probably benign	Het
Olfr1318	A	G	2: 112,156,019	I23V	probably benign	Het
Olfr1487	T	C	19: 13,619,366	V25A	probably benign	Het
Olfr584	A	T	7: 103,085,667	I45F	probably benign	Het
Olfr622	A	G	7: 103,639,591	M183T	probably damaging	Het
Olfr95	T	C	17: 37,211,626	T76A	probably benign	Het
Omd	T	A	13: 49,589,991	N172K	probably damaging	Het
Orc1	T	C	4: 108,590,670	I38T	probably benign	Het
Oxct1	A	G	15: 4,142,822	T457A	possibly damaging	Het
Pcdh17	A	T	14: 84,477,668	K924N	probably benign	Het
Pkhd1l1	A	T	15: 44,570,028	I3435F	probably damaging	Het
Psg20	C	A	7: 18,682,679	V171F	probably damaging	Het
Rab11fip2	A	T	19: 59,937,099	S87T	probably damaging	Het
Rabgap1l	T	C	1: 160,231,849	T237A	probably benign	Het
Rasgrp1	A	T	2: 117,291,792	Y372*	probably null	Het
Rell1	G	T	5: 63,939,705		probably benign	Het
Rps14	A	G	18: 60,776,961	K61E	possibly damaging	Het
Rtl6	A	G	15: 84,557,120	V25A	possibly damaging	Het
Ryr2	G	T	13: 11,879,496	S185R	probably damaging	Het
Slc10a2	C	T	8: 5,091,621		probably null	Het
Slc14a1	T	A	18: 78,110,058		probably null	Het
Smad2	A	T	18: 76,289,162	N215I	probably benign	Het
Smchd1	A	T	17: 71,370,927	N1473K	probably benign	Het
Spag9	A	G	11: 94,093,485		probably null	Het
Stk31	A	C	6: 49,417,344	R213S	probably benign	Het
Tmod4	A	T	3: 95,128,306	Q255L	probably benign	Het
Tnpo1	T	A	13: 98,890,774	Y3F	probably benign	Het
Tom1l1	A	C	11: 90,661,761	Y206*	probably null	Het
Tulp2	A	G	7: 45,514,692	K36E	probably damaging	Het
Tulp4	C	T	17: 6,201,819	R282C	probably damaging	Het
Unc5b	A	T	10: 60,778,331	N246K	possibly damaging	Het
Ush2a	C	G	1: 188,536,370	S1674R	possibly damaging	Het
Vmn1r224	T	C	17: 20,419,821	I220T	probably benign	Het
Vmn1r7	G	C	6: 57,024,419	N285K	probably benign	Het
Vmn2r83	C	T	10: 79,477,854	P99S	probably damaging	Het
Zbtb38	A	G	9: 96,687,229	F601L	probably benign	Het
Zc3h3	A	T	15: 75,809,568	S555T	possibly damaging	Het

Other mutations in Cacna1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Cacna1b	APN	2	24651200	nonsense	probably null
IGL00508:Cacna1b	APN	2	24657289	critical splice donor site	probably null
IGL01085:Cacna1b	APN	2	24678994	missense	probably damaging	0.98
IGL01310:Cacna1b	APN	2	24685782	missense	probably damaging	1.00
IGL01361:Cacna1b	APN	2	24679095	missense	possibly damaging	0.49
IGL01471:Cacna1b	APN	2	24657292	missense	probably damaging	1.00
IGL01537:Cacna1b	APN	2	24658528	missense	probably damaging	1.00
IGL01547:Cacna1b	APN	2	24632035	unclassified	probably benign
IGL01750:Cacna1b	APN	2	24654395	missense	probably damaging	1.00
IGL01813:Cacna1b	APN	2	24609890	missense	probably damaging	1.00
IGL01939:Cacna1b	APN	2	24661757	missense	probably damaging	1.00
IGL01955:Cacna1b	APN	2	24639137	missense	probably damaging	1.00
IGL01972:Cacna1b	APN	2	24635095	critical splice donor site	probably null
IGL01987:Cacna1b	APN	2	24697567	splice site	probably null
IGL02096:Cacna1b	APN	2	24678915	missense	probably benign	0.01
IGL02111:Cacna1b	APN	2	24606991	missense	probably damaging	0.96
IGL02254:Cacna1b	APN	2	24616815	splice site	probably null
IGL03084:Cacna1b	APN	2	24609932	missense	probably benign
IGL03184:Cacna1b	APN	2	24658489	critical splice donor site	probably null
IGL03202:Cacna1b	APN	2	24651112	missense	probably damaging	1.00
IGL03210:Cacna1b	APN	2	24650572	missense	probably benign	0.00
IGL03402:Cacna1b	APN	2	24762809	missense	probably damaging	1.00
PIT4283001:Cacna1b	UTSW	2	24631941	missense	probably damaging	1.00
R0062:Cacna1b	UTSW	2	24758331	missense	probably damaging	1.00
R0062:Cacna1b	UTSW	2	24758331	missense	probably damaging	1.00
R0206:Cacna1b	UTSW	2	24607480	missense	probably damaging	1.00
R0208:Cacna1b	UTSW	2	24607480	missense	probably damaging	1.00
R0240:Cacna1b	UTSW	2	24638657	unclassified	probably benign
R0265:Cacna1b	UTSW	2	24761844	missense	probably damaging	1.00
R0352:Cacna1b	UTSW	2	24625232	intron	probably benign
R0376:Cacna1b	UTSW	2	24659003	splice site	probably benign
R0383:Cacna1b	UTSW	2	24761844	missense	probably damaging	1.00
R0432:Cacna1b	UTSW	2	24687704	missense	probably damaging	1.00
R0595:Cacna1b	UTSW	2	24649989	splice site	probably benign
R0660:Cacna1b	UTSW	2	24654446	missense	probably damaging	1.00
R0664:Cacna1b	UTSW	2	24654446	missense	probably damaging	1.00
R1107:Cacna1b	UTSW	2	24697603	missense	probably damaging	1.00
R1184:Cacna1b	UTSW	2	24687745	splice site	probably null
R1445:Cacna1b	UTSW	2	24718136	splice site	probably benign
R1446:Cacna1b	UTSW	2	24706177	missense	probably benign	0.01
R1496:Cacna1b	UTSW	2	24678035	missense	probably benign
R1614:Cacna1b	UTSW	2	24690807	missense	possibly damaging	0.88
R1626:Cacna1b	UTSW	2	24606709	missense	probably damaging	1.00
R1917:Cacna1b	UTSW	2	24616879	missense	probably null	0.80
R1984:Cacna1b	UTSW	2	24648986	missense	probably damaging	1.00
R1986:Cacna1b	UTSW	2	24648986	missense	probably damaging	1.00
R1989:Cacna1b	UTSW	2	24721374	missense	probably damaging	1.00
R1990:Cacna1b	UTSW	2	24732306	missense	probably damaging	1.00
R1991:Cacna1b	UTSW	2	24732306	missense	probably damaging	1.00
R1992:Cacna1b	UTSW	2	24732306	missense	probably damaging	1.00
R2098:Cacna1b	UTSW	2	24650546	missense	probably damaging	1.00
R2139:Cacna1b	UTSW	2	24679473	missense	probably benign	0.07
R2196:Cacna1b	UTSW	2	24761788	missense	probably damaging	1.00
R2229:Cacna1b	UTSW	2	24685804	missense	probably damaging	1.00
R2292:Cacna1b	UTSW	2	24606620	missense	probably benign	0.01
R2570:Cacna1b	UTSW	2	24606637	nonsense	probably null
R2850:Cacna1b	UTSW	2	24761788	missense	probably damaging	1.00
R2911:Cacna1b	UTSW	2	24607541	splice site	probably null
R2937:Cacna1b	UTSW	2	24606528	missense	probably benign	0.00
R2938:Cacna1b	UTSW	2	24606528	missense	probably benign	0.00
R3522:Cacna1b	UTSW	2	24763043	missense	possibly damaging	0.94
R3800:Cacna1b	UTSW	2	24658959	missense	probably benign	0.15
R4166:Cacna1b	UTSW	2	24677911	missense	probably benign	0.32
R4300:Cacna1b	UTSW	2	24635239	missense	probably damaging	1.00
R4366:Cacna1b	UTSW	2	24702620	missense	probably damaging	1.00
R4493:Cacna1b	UTSW	2	24652938	missense	probably damaging	0.99
R4494:Cacna1b	UTSW	2	24652938	missense	probably damaging	0.99
R4522:Cacna1b	UTSW	2	24654430	missense	probably damaging	1.00
R4612:Cacna1b	UTSW	2	24626852	nonsense	probably null
R4673:Cacna1b	UTSW	2	24631944	missense	probably damaging	1.00
R4703:Cacna1b	UTSW	2	24654463	missense	probably damaging	1.00
R4704:Cacna1b	UTSW	2	24654463	missense	probably damaging	1.00
R4777:Cacna1b	UTSW	2	24732325	missense	probably damaging	1.00
R4795:Cacna1b	UTSW	2	24637487	missense	possibly damaging	0.58
R4796:Cacna1b	UTSW	2	24637487	missense	possibly damaging	0.58
R4962:Cacna1b	UTSW	2	24618318	missense	probably damaging	1.00
R4962:Cacna1b	UTSW	2	24657366	missense	probably damaging	1.00
R4974:Cacna1b	UTSW	2	24648523	missense	probably damaging	0.99
R4990:Cacna1b	UTSW	2	24678874	critical splice donor site	probably null
R5109:Cacna1b	UTSW	2	24690785	missense	possibly damaging	0.88
R5117:Cacna1b	UTSW	2	24732328	missense	probably damaging	1.00
R5176:Cacna1b	UTSW	2	24635131	missense	probably damaging	1.00
R5253:Cacna1b	UTSW	2	24719952	missense	probably damaging	1.00
R5372:Cacna1b	UTSW	2	24733959	missense	probably damaging	1.00
R5374:Cacna1b	UTSW	2	24706216	missense	probably damaging	1.00
R5465:Cacna1b	UTSW	2	24650426	critical splice donor site	probably null
R5568:Cacna1b	UTSW	2	24607600	missense	probably damaging	1.00
R5580:Cacna1b	UTSW	2	24650554	missense	probably damaging	1.00
R5677:Cacna1b	UTSW	2	24679358	missense	possibly damaging	0.64
R6277:Cacna1b	UTSW	2	24730796	missense	probably damaging	1.00
R6609:Cacna1b	UTSW	2	24653049	missense	probably damaging	1.00
R6929:Cacna1b	UTSW	2	24632010	missense	probably damaging	1.00
R7016:Cacna1b	UTSW	2	24762848	missense	possibly damaging	0.77
R7112:Cacna1b	UTSW	2	24690761	missense	probably damaging	0.97
R7162:Cacna1b	UTSW	2	24700022	missense	probably benign	0.06
R7401:Cacna1b	UTSW	2	24679294	missense	probably benign	0.00
R7402:Cacna1b	UTSW	2	24607659	missense	probably benign	0.21
R7442:Cacna1b	UTSW	2	24607501	missense	probably benign
R7450:Cacna1b	UTSW	2	24635135	nonsense	probably null
R7481:Cacna1b	UTSW	2	24616862	missense	probably damaging	0.99
R7792:Cacna1b	UTSW	2	24677965	missense	probably damaging	0.99
R7999:Cacna1b	UTSW	2	24650626	missense	probably damaging	1.00
R8041:Cacna1b	UTSW	2	24657299	missense	probably damaging	1.00
R8084:Cacna1b	UTSW	2	24685796	missense	probably benign	0.21
R8147:Cacna1b	UTSW	2	24679176	missense	probably damaging	0.97
R8170:Cacna1b	UTSW	2	24678874	critical splice donor site	probably null
R8371:Cacna1b	UTSW	2	24720024	missense	possibly damaging	0.46
R8391:Cacna1b	UTSW	2	24706200	missense	probably damaging	1.00
Z1088:Cacna1b	UTSW	2	24661844	missense	probably damaging	1.00
Z1088:Cacna1b	UTSW	2	24733945	missense	probably damaging	1.00
Z1176:Cacna1b	UTSW	2	24626884	nonsense	probably null
Z1177:Cacna1b	UTSW	2	24638677	missense	probably damaging	0.98
Z1177:Cacna1b	UTSW	2	24661790	missense	probably damaging	1.00
Z1177:Cacna1b	UTSW	2	24678988	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TGCAGGTATGAAACTTCTAGAAGC -3'
(R):5'- TAAAGCAGCTGGGTCTCTGC -3'

Sequencing Primer
(F):5'- GAAACTTCTAGAAGCAACATTGTCC -3'
(R):5'- AGGCATGCAGTCACAGC -3'

Posted On

2018-03-15