Mutagenetix > Incidental Mutations

Incidental Mutation 'R4673:Cacna1b'

348591

Institutional Source

Beutler Lab

Gene Symbol

Cacna1b

Ensembl Gene

ENSMUSG00000004113

Gene Name

calcium channel, voltage-dependent, N type, alpha 1B subunit

Synonyms

alpha(1B), Cav2.2, Cchn1a

MMRRC Submission

041928-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4673 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

24603887-24763152 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 24631944 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Serine at position 1718 (L1718S)

Ref Sequence

ENSEMBL: ENSMUSP00000110090 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041342] [ENSMUST00000070864] [ENSMUST00000100348] [ENSMUST00000102939] [ENSMUST00000114447]

Predicted Effect

probably damaging
Transcript: ENSMUST00000041342
AA Change: L1717S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000037416
Gene: ENSMUSG00000004113
AA Change: L1717S

Domain	Start	End	E-Value	Type
low complexity region	9	40	N/A	INTRINSIC
Pfam:Ion_trans	133	355	1.2e-57	PFAM
PDB:4DEX\|B	358	467	8e-66	PDB
Pfam:Ion_trans	516	708	1.1e-47	PFAM
Pfam:PKD_channel	569	715	2.3e-7	PFAM
low complexity region	728	739	N/A	INTRINSIC
low complexity region	849	858	N/A	INTRINSIC
low complexity region	903	913	N/A	INTRINSIC
low complexity region	916	933	N/A	INTRINSIC
low complexity region	1091	1102	N/A	INTRINSIC
Pfam:Ion_trans	1174	1408	2.7e-52	PFAM
Pfam:Ion_trans	1498	1698	1.2e-59	PFAM
Pfam:PKD_channel	1551	1705	8.1e-9	PFAM
Ca_chan_IQ	1837	1871	1.09e-11	SMART
low complexity region	2040	2050	N/A	INTRINSIC
low complexity region	2092	2114	N/A	INTRINSIC
low complexity region	2276	2292	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000070864
AA Change: L1714S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000063236
Gene: ENSMUSG00000004113
AA Change: L1714S

Domain	Start	End	E-Value	Type
low complexity region	9	40	N/A	INTRINSIC
Pfam:Ion_trans	133	355	1.4e-57	PFAM
PDB:4DEX\|B	358	467	8e-66	PDB
Pfam:Ion_trans	516	708	1.2e-47	PFAM
Pfam:PKD_channel	569	715	1.5e-7	PFAM
low complexity region	728	739	N/A	INTRINSIC
low complexity region	848	857	N/A	INTRINSIC
low complexity region	902	912	N/A	INTRINSIC
low complexity region	915	932	N/A	INTRINSIC
low complexity region	1090	1101	N/A	INTRINSIC
Pfam:Ion_trans	1173	1403	1.8e-52	PFAM
Pfam:Ion_trans	1493	1695	5.4e-60	PFAM
Pfam:PKD_channel	1544	1702	4.9e-9	PFAM
Ca_chan_IQ	1798	1832	7.2e-12	SMART
low complexity region	2001	2011	N/A	INTRINSIC
low complexity region	2053	2075	N/A	INTRINSIC
low complexity region	2237	2253	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000100348
AA Change: L1718S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000097920
Gene: ENSMUSG00000004113
AA Change: L1718S

Domain	Start	End	E-Value	Type
low complexity region	9	40	N/A	INTRINSIC
Pfam:Ion_trans	133	355	1.4e-57	PFAM
PDB:4DEX\|B	358	468	5e-68	PDB
Pfam:Ion_trans	517	709	1.2e-47	PFAM
Pfam:PKD_channel	570	716	1.6e-7	PFAM
low complexity region	729	740	N/A	INTRINSIC
low complexity region	850	859	N/A	INTRINSIC
low complexity region	904	914	N/A	INTRINSIC
low complexity region	917	934	N/A	INTRINSIC
low complexity region	1092	1103	N/A	INTRINSIC
Pfam:Ion_trans	1175	1409	3.2e-52	PFAM
Pfam:Ion_trans	1499	1699	1.4e-59	PFAM
Pfam:PKD_channel	1552	1706	5.6e-9	PFAM
Ca_chan_IQ	1838	1872	1.09e-11	SMART
low complexity region	2041	2051	N/A	INTRINSIC
low complexity region	2093	2115	N/A	INTRINSIC
low complexity region	2277	2293	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000102939
AA Change: L1715S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000100003
Gene: ENSMUSG00000004113
AA Change: L1715S

Domain	Start	End	E-Value	Type
low complexity region	9	40	N/A	INTRINSIC
Pfam:Ion_trans	133	355	1.4e-57	PFAM
PDB:4DEX\|B	358	467	1e-65	PDB
Pfam:Ion_trans	516	708	1.2e-47	PFAM
Pfam:PKD_channel	569	715	1.6e-7	PFAM
low complexity region	728	739	N/A	INTRINSIC
low complexity region	849	858	N/A	INTRINSIC
low complexity region	903	913	N/A	INTRINSIC
low complexity region	916	933	N/A	INTRINSIC
low complexity region	1091	1102	N/A	INTRINSIC
Pfam:Ion_trans	1174	1404	1.9e-52	PFAM
Pfam:Ion_trans	1494	1696	5.5e-60	PFAM
Pfam:PKD_channel	1545	1703	5e-9	PFAM
Ca_chan_IQ	1835	1869	1.09e-11	SMART
low complexity region	2038	2048	N/A	INTRINSIC
low complexity region	2090	2112	N/A	INTRINSIC
low complexity region	2274	2290	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000114447
AA Change: L1718S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110090
Gene: ENSMUSG00000004113
AA Change: L1718S

Domain	Start	End	E-Value	Type
low complexity region	9	40	N/A	INTRINSIC
Pfam:Ion_trans	94	367	8.5e-69	PFAM
Pfam:Ion_trans	482	721	2.4e-57	PFAM
Pfam:PKD_channel	571	715	1e-7	PFAM
low complexity region	729	740	N/A	INTRINSIC
low complexity region	850	859	N/A	INTRINSIC
low complexity region	904	914	N/A	INTRINSIC
low complexity region	917	934	N/A	INTRINSIC
low complexity region	1092	1103	N/A	INTRINSIC
Pfam:Ion_trans	1139	1421	1.3e-62	PFAM
Pfam:Ion_trans	1464	1711	3.2e-64	PFAM
Pfam:PKD_channel	1550	1706	2.7e-9	PFAM
Pfam:GPHH	1713	1783	1.9e-39	PFAM
Ca_chan_IQ	1838	1872	1.09e-11	SMART
low complexity region	2041	2051	N/A	INTRINSIC
low complexity region	2093	2115	N/A	INTRINSIC
low complexity region	2277	2293	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000125798
AA Change: L94S

Predicted Effect

unknown
Transcript: ENSMUST00000155356
AA Change: L27S

SMART Domains

Protein: ENSMUSP00000116674
Gene: ENSMUSG00000004113
AA Change: L27S

Domain	Start	End	E-Value	Type
Pfam:GPHH	23	93	5.4e-39	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the pore-forming subunit of an N-type voltage-dependent calcium channel, which controls neurotransmitter release from neurons. The encoded protein forms a complex with alpha-2, beta, and delta subunits to form the high-voltage activated channel. This channel is sensitive to omega-conotoxin-GVIA and omega-agatoxin-IIIA but insensitive to dihydropyridines. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice deficient in this gene exhibit defects in nociception, memory and learning. They also exhibit hyperactive and hyperaggressive behaviors as well as defects in the the sleep-wake cycle. Deficits in the sympathetic nervous system results in defects in circulatory regulation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam32	T	C	8: 24,884,455	E507G	probably damaging	Het
Adam39	C	T	8: 40,824,731	T53I	probably benign	Het
Adam4	A	T	12: 81,421,761	S29T	possibly damaging	Het
Adamdec1	C	A	14: 68,577,904	E104*	probably null	Het
Alas1	G	T	9: 106,236,477	P523Q	probably damaging	Het
Aldh3a1	A	G	11: 61,213,494	D69G	probably benign	Het
Arhgap29	T	A	3: 122,014,971	V1266E	probably damaging	Het
Bcdin3d	T	C	15: 99,470,838	D160G	probably damaging	Het
Btaf1	T	A	19: 36,978,372	F569I	probably benign	Het
Casd1	A	G	6: 4,629,975	Y457C	probably damaging	Het
Creb3	T	C	4: 43,563,192	V97A	probably benign	Het
Cux2	G	T	5: 121,887,476	S43*	probably null	Het
Fam160a1	A	T	3: 85,730,713	V93D	probably damaging	Het
Fsbp	T	G	4: 11,579,841	N36K	probably benign	Het
Gm11565	A	G	11: 99,915,214	D144G	probably benign	Het
Gm7534	G	A	4: 134,200,347	A365V	probably benign	Het
Gpn3	A	G	5: 122,373,918	Y19C	probably damaging	Het
Gstz1	A	T	12: 87,162,063	T148S	probably benign	Het
Gtf3c5	A	G	2: 28,572,224	I282T	probably benign	Het
Hspa2	T	A	12: 76,405,740	S403T	possibly damaging	Het
Il27	G	A	7: 126,591,079	T121I	possibly damaging	Het
Itpr2	A	G	6: 146,373,173	F837S	probably damaging	Het
Kctd1	T	A	18: 15,063,227		probably benign	Het
Kynu	A	G	2: 43,679,803	T366A	probably damaging	Het
Lama5	G	A	2: 180,199,266	T507I	probably damaging	Het
Myh11	C	T	16: 14,269,241	V124M	probably damaging	Het
Myh14	T	A	7: 44,624,330	H1331L	probably damaging	Het
Myh2	T	A	11: 67,188,477	L957Q	probably damaging	Het
Myh4	T	C	11: 67,246,401	F483L	probably benign	Het
Nbeal1	A	C	1: 60,329,390	K2631N	probably damaging	Het
Ofcc1	G	A	13: 40,015,388	T841I	probably damaging	Het
Ogg1	T	C	6: 113,327,307	C28R	probably damaging	Het
Olfr1449	G	A	19: 12,935,097	A120T	probably damaging	Het
Olfr157	T	C	4: 43,836,430	H20R	probably benign	Het
Olfr181	C	T	16: 58,925,690	V294I	possibly damaging	Het
Olfr49	C	T	14: 54,282,332	A188T	possibly damaging	Het
Olfr855	A	G	9: 19,585,430	K298E	possibly damaging	Het
Parp6	G	C	9: 59,640,110	R460P	probably damaging	Het
Phf14	A	G	6: 11,992,057	H744R	probably damaging	Het
Pibf1	A	G	14: 99,133,351	N263S	possibly damaging	Het
Plcb4	A	G	2: 135,932,271	T158A	possibly damaging	Het
Plce1	T	C	19: 38,749,396	S1615P	possibly damaging	Het
Plxna3	T	G	X: 74,338,948		probably null	Het
Rad54b	T	A	4: 11,609,449	H633Q	probably benign	Het
Rgs22	T	A	15: 36,099,933	Y212F	probably benign	Het
Rnd3	G	A	2: 51,132,541	A163V	probably benign	Het
Rnf10	A	T	5: 115,251,089	V315E	probably damaging	Het
Robo2	C	T	16: 73,904,378		probably null	Het
Rp1l1	T	G	14: 64,031,270	V1435G	probably damaging	Het
Scaf8	T	A	17: 3,197,985	D1194E	probably benign	Het
Sept12	T	C	16: 4,991,943	T198A	probably damaging	Het
Shisa2	A	G	14: 59,630,180	T294A	probably damaging	Het
Spta1	A	G	1: 174,191,062		probably null	Het
Strbp	A	T	2: 37,645,679	S6T	probably damaging	Het
Syf2	A	G	4: 134,934,493	E56G	probably damaging	Het
Thap4	T	C	1: 93,714,866		probably benign	Het
Tnfaip3	T	C	10: 19,011,832		probably benign	Het
Tnxb	A	G	17: 34,672,540	E619G	probably damaging	Het
Tpr	G	A	1: 150,423,567	A1173T	probably benign	Het
Tspan3	G	A	9: 56,136,696	R240W	probably damaging	Het
Ubr4	C	T	4: 139,410,716	S1128L	probably damaging	Het
Ucp1	T	C	8: 83,295,247	V236A	probably damaging	Het
Usp34	TCACCACCACCACCACCACCACCACCAC	TCACCACCACCACCACCACCACCAC	11: 23,364,480		probably benign	Het
Zcchc6	G	T	13: 59,796,845	T658K	probably damaging	Het
Zfp940	T	C	7: 29,845,438	D348G	probably benign	Het

Other mutations in Cacna1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Cacna1b	APN	2	24651200	nonsense	probably null
IGL00508:Cacna1b	APN	2	24657289	critical splice donor site	probably null
IGL01085:Cacna1b	APN	2	24678994	missense	probably damaging	0.98
IGL01310:Cacna1b	APN	2	24685782	missense	probably damaging	1.00
IGL01361:Cacna1b	APN	2	24679095	missense	possibly damaging	0.49
IGL01471:Cacna1b	APN	2	24657292	missense	probably damaging	1.00
IGL01537:Cacna1b	APN	2	24658528	missense	probably damaging	1.00
IGL01547:Cacna1b	APN	2	24632035	unclassified	probably benign
IGL01750:Cacna1b	APN	2	24654395	missense	probably damaging	1.00
IGL01813:Cacna1b	APN	2	24609890	missense	probably damaging	1.00
IGL01939:Cacna1b	APN	2	24661757	missense	probably damaging	1.00
IGL01955:Cacna1b	APN	2	24639137	missense	probably damaging	1.00
IGL01972:Cacna1b	APN	2	24635095	critical splice donor site	probably null
IGL01987:Cacna1b	APN	2	24697567	splice site	probably null
IGL02096:Cacna1b	APN	2	24678915	missense	probably benign	0.01
IGL02111:Cacna1b	APN	2	24606991	missense	probably damaging	0.96
IGL02254:Cacna1b	APN	2	24616815	splice site	probably null
IGL03084:Cacna1b	APN	2	24609932	missense	probably benign
IGL03184:Cacna1b	APN	2	24658489	critical splice donor site	probably null
IGL03202:Cacna1b	APN	2	24651112	missense	probably damaging	1.00
IGL03210:Cacna1b	APN	2	24650572	missense	probably benign	0.00
IGL03402:Cacna1b	APN	2	24762809	missense	probably damaging	1.00
PIT4283001:Cacna1b	UTSW	2	24631941	missense	probably damaging	1.00
R0062:Cacna1b	UTSW	2	24758331	missense	probably damaging	1.00
R0062:Cacna1b	UTSW	2	24758331	missense	probably damaging	1.00
R0206:Cacna1b	UTSW	2	24607480	missense	probably damaging	1.00
R0208:Cacna1b	UTSW	2	24607480	missense	probably damaging	1.00
R0240:Cacna1b	UTSW	2	24638657	unclassified	probably benign
R0265:Cacna1b	UTSW	2	24761844	missense	probably damaging	1.00
R0352:Cacna1b	UTSW	2	24625232	intron	probably benign
R0376:Cacna1b	UTSW	2	24659003	splice site	probably benign
R0383:Cacna1b	UTSW	2	24761844	missense	probably damaging	1.00
R0432:Cacna1b	UTSW	2	24687704	missense	probably damaging	1.00
R0595:Cacna1b	UTSW	2	24649989	splice site	probably benign
R0660:Cacna1b	UTSW	2	24654446	missense	probably damaging	1.00
R0664:Cacna1b	UTSW	2	24654446	missense	probably damaging	1.00
R1107:Cacna1b	UTSW	2	24697603	missense	probably damaging	1.00
R1184:Cacna1b	UTSW	2	24687745	unclassified	probably null
R1445:Cacna1b	UTSW	2	24718136	splice site	probably benign
R1446:Cacna1b	UTSW	2	24706177	missense	probably benign	0.01
R1496:Cacna1b	UTSW	2	24678035	missense	probably benign
R1614:Cacna1b	UTSW	2	24690807	missense	possibly damaging	0.88
R1626:Cacna1b	UTSW	2	24606709	missense	probably damaging	1.00
R1917:Cacna1b	UTSW	2	24616879	missense	probably null	0.80
R1984:Cacna1b	UTSW	2	24648986	missense	probably damaging	1.00
R1986:Cacna1b	UTSW	2	24648986	missense	probably damaging	1.00
R1989:Cacna1b	UTSW	2	24721374	missense	probably damaging	1.00
R1990:Cacna1b	UTSW	2	24732306	missense	probably damaging	1.00
R1991:Cacna1b	UTSW	2	24732306	missense	probably damaging	1.00
R1992:Cacna1b	UTSW	2	24732306	missense	probably damaging	1.00
R2098:Cacna1b	UTSW	2	24650546	missense	probably damaging	1.00
R2139:Cacna1b	UTSW	2	24679473	missense	probably benign	0.07
R2196:Cacna1b	UTSW	2	24761788	missense	probably damaging	1.00
R2229:Cacna1b	UTSW	2	24685804	missense	probably damaging	1.00
R2292:Cacna1b	UTSW	2	24606620	missense	probably benign	0.01
R2570:Cacna1b	UTSW	2	24606637	nonsense	probably null
R2850:Cacna1b	UTSW	2	24761788	missense	probably damaging	1.00
R2911:Cacna1b	UTSW	2	24607541	unclassified	probably null
R2937:Cacna1b	UTSW	2	24606528	missense	probably benign	0.00
R2938:Cacna1b	UTSW	2	24606528	missense	probably benign	0.00
R3522:Cacna1b	UTSW	2	24763043	missense	possibly damaging	0.94
R3800:Cacna1b	UTSW	2	24658959	missense	probably benign	0.15
R4166:Cacna1b	UTSW	2	24677911	missense	probably benign	0.32
R4300:Cacna1b	UTSW	2	24635239	missense	probably damaging	1.00
R4366:Cacna1b	UTSW	2	24702620	missense	probably damaging	1.00
R4493:Cacna1b	UTSW	2	24652938	missense	probably damaging	0.99
R4494:Cacna1b	UTSW	2	24652938	missense	probably damaging	0.99
R4522:Cacna1b	UTSW	2	24654430	missense	probably damaging	1.00
R4612:Cacna1b	UTSW	2	24626852	nonsense	probably null
R4703:Cacna1b	UTSW	2	24654463	missense	probably damaging	1.00
R4704:Cacna1b	UTSW	2	24654463	missense	probably damaging	1.00
R4777:Cacna1b	UTSW	2	24732325	missense	probably damaging	1.00
R4795:Cacna1b	UTSW	2	24637487	missense	possibly damaging	0.58
R4796:Cacna1b	UTSW	2	24637487	missense	possibly damaging	0.58
R4962:Cacna1b	UTSW	2	24618318	missense	probably damaging	1.00
R4962:Cacna1b	UTSW	2	24657366	missense	probably damaging	1.00
R4974:Cacna1b	UTSW	2	24648523	missense	probably damaging	0.99
R4990:Cacna1b	UTSW	2	24678874	critical splice donor site	probably null
R5109:Cacna1b	UTSW	2	24690785	missense	possibly damaging	0.88
R5117:Cacna1b	UTSW	2	24732328	missense	probably damaging	1.00
R5176:Cacna1b	UTSW	2	24635131	missense	probably damaging	1.00
R5253:Cacna1b	UTSW	2	24719952	missense	probably damaging	1.00
R5372:Cacna1b	UTSW	2	24733959	missense	probably damaging	1.00
R5374:Cacna1b	UTSW	2	24706216	missense	probably damaging	1.00
R5465:Cacna1b	UTSW	2	24650426	critical splice donor site	probably null
R5568:Cacna1b	UTSW	2	24607600	missense	probably damaging	1.00
R5580:Cacna1b	UTSW	2	24650554	missense	probably damaging	1.00
R5677:Cacna1b	UTSW	2	24679358	missense	possibly damaging	0.64
R6277:Cacna1b	UTSW	2	24730796	missense	probably damaging	1.00
R6294:Cacna1b	UTSW	2	24719057	missense	possibly damaging	0.94
R6609:Cacna1b	UTSW	2	24653049	missense	probably damaging	1.00
R6929:Cacna1b	UTSW	2	24632010	missense	probably damaging	1.00
R7016:Cacna1b	UTSW	2	24762848	missense	possibly damaging	0.77
R7112:Cacna1b	UTSW	2	24690761	missense	probably damaging	0.97
R7162:Cacna1b	UTSW	2	24700022	missense	probably benign	0.06
R7401:Cacna1b	UTSW	2	24679294	missense	probably benign	0.00
R7402:Cacna1b	UTSW	2	24607659	missense	probably benign	0.21
R7442:Cacna1b	UTSW	2	24607501	missense	probably benign
R7450:Cacna1b	UTSW	2	24635135	nonsense	probably null
R7481:Cacna1b	UTSW	2	24616862	missense	probably damaging	0.99
R7792:Cacna1b	UTSW	2	24677965	missense	probably damaging	0.99
Z1088:Cacna1b	UTSW	2	24661844	missense	probably damaging	1.00
Z1088:Cacna1b	UTSW	2	24733945	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTGCTAAGACACACAGAACTG -3'
(R):5'- AGACGCTAGAAAGTTCCAGC -3'

Sequencing Primer
(F):5'- TGGGTAAGTCCTAGGCCTCAGATC -3'
(R):5'- AAAGTTCCAGCAGGTCTGTC -3'

Posted On

2015-10-08