Incidental Mutation 'R6301:Acot10'
ID 509121
Institutional Source Beutler Lab
Gene Symbol Acot10
Ensembl Gene ENSMUSG00000047565
Gene Name acyl-CoA thioesterase 10
Synonyms p48, MT-ACT48, Acate3
MMRRC Submission 044466-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.127) question?
Stock # R6301 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 20665300-20666836 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 20666348 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 131 (N131S)
Ref Sequence ENSEMBL: ENSMUSP00000051333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052910]
AlphaFold Q32MW3
Predicted Effect probably benign
Transcript: ENSMUST00000052910
AA Change: N131S

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000051333
Gene: ENSMUSG00000047565
AA Change: N131S

DomainStartEndE-ValueType
SCOP:d1lo7a_ 108 222 1e-4 SMART
PDB:4IEN|D 277 400 3e-6 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226407
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227439
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228652
Meta Mutation Damage Score 0.0800 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4fm2 C T 4: 144,285,224 (GRCm39) A138T probably damaging Het
Agbl5 A G 5: 31,049,177 (GRCm39) Y220C probably damaging Het
Ankdd1a C T 9: 65,415,343 (GRCm39) A227T possibly damaging Het
Ap3b1 A T 13: 94,664,803 (GRCm39) Q914L unknown Het
Arhgef25 T C 10: 127,021,751 (GRCm39) D216G possibly damaging Het
Bcas2 T A 3: 103,079,187 (GRCm39) probably benign Het
Bpifb5 A C 2: 154,072,139 (GRCm39) H282P possibly damaging Het
Ccdc121rt2 A T 5: 112,598,334 (GRCm39) I294F possibly damaging Het
Ccdc167 A G 17: 29,924,556 (GRCm39) I15T probably damaging Het
Cd248 A G 19: 5,120,009 (GRCm39) N619S probably benign Het
Chrna1 A G 2: 73,400,828 (GRCm39) F234S possibly damaging Het
Clcc1 T G 3: 108,580,682 (GRCm39) M332R probably damaging Het
Cmklr1 T A 5: 113,752,999 (GRCm39) M1L possibly damaging Het
Cntnap5c A G 17: 58,199,032 (GRCm39) M109V probably benign Het
Coq2 A G 5: 100,809,729 (GRCm39) I18T possibly damaging Het
Crybg3 T C 16: 59,350,701 (GRCm39) S880G probably damaging Het
Cubn A G 2: 13,482,889 (GRCm39) C286R probably damaging Het
Defa24 T C 8: 22,225,299 (GRCm39) V63A probably benign Het
Dnah6 C T 6: 73,063,200 (GRCm39) R2634H probably damaging Het
Dusp8 T A 7: 141,636,756 (GRCm39) probably null Het
Elac1 T C 18: 73,871,939 (GRCm39) D352G probably damaging Het
Ermap A T 4: 119,042,800 (GRCm39) V241E probably damaging Het
Fgf10 T A 13: 118,852,047 (GRCm39) M43K probably benign Het
Gabrd A G 4: 155,471,724 (GRCm39) V193A probably damaging Het
Hectd4 T G 5: 121,392,283 (GRCm39) C182W possibly damaging Het
Hook3 C T 8: 26,524,968 (GRCm39) W26* probably null Het
Kif1a C A 1: 92,982,663 (GRCm39) E714* probably null Het
Krt6b T C 15: 101,587,386 (GRCm39) E236G probably damaging Het
Large2 A G 2: 92,199,861 (GRCm39) L209P probably damaging Het
Lats1 A G 10: 7,578,871 (GRCm39) N665S probably benign Het
Lrrc37 A T 11: 103,509,756 (GRCm39) probably benign Het
Lrrtm3 T C 10: 63,925,001 (GRCm39) I55M probably benign Het
Ltk A G 2: 119,582,238 (GRCm39) S838P probably damaging Het
Ltn1 T C 16: 87,217,194 (GRCm39) I348V probably benign Het
Mag T A 7: 30,600,104 (GRCm39) S559C probably damaging Het
Mink1 A G 11: 70,503,120 (GRCm39) H1072R possibly damaging Het
Mycbp2 T A 14: 103,392,862 (GRCm39) Q833L probably damaging Het
Myh4 G A 11: 67,146,159 (GRCm39) E1406K possibly damaging Het
Npc1 C T 18: 12,330,302 (GRCm39) V950I probably benign Het
Npl A G 1: 153,394,627 (GRCm39) probably null Het
Or10w3 A G 19: 13,703,753 (GRCm39) I43V probably benign Het
Or11g27 T A 14: 50,771,711 (GRCm39) F281I probably benign Het
Or2m13 A T 16: 19,226,167 (GRCm39) F200I possibly damaging Het
Or8b36 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 37,937,836 (GRCm39) probably null Het
Oxsm A T 14: 16,242,220 (GRCm38) I183N probably damaging Het
Pde7a T C 3: 19,297,327 (GRCm39) I108V probably benign Het
Pgghg A T 7: 140,526,289 (GRCm39) T585S probably damaging Het
Pkhd1l1 G A 15: 44,452,921 (GRCm39) D3949N probably damaging Het
Ralgapa2 A T 2: 146,169,331 (GRCm39) H1777Q possibly damaging Het
Rela G A 19: 5,695,438 (GRCm39) probably null Het
Rilpl1 C A 5: 124,652,602 (GRCm39) G41W probably damaging Het
Rp1 T C 1: 4,417,477 (GRCm39) K1212E probably benign Het
Sgca A C 11: 94,863,393 (GRCm39) L28V probably damaging Het
Ssmem1 A G 6: 30,519,758 (GRCm39) R148G probably damaging Het
St8sia5 A T 18: 77,333,836 (GRCm39) N165Y probably damaging Het
Tbl2 A T 5: 135,188,223 (GRCm39) H339L probably benign Het
Tcof1 G A 18: 60,961,897 (GRCm39) P718L probably damaging Het
Trim72 A T 7: 127,603,786 (GRCm39) E44V possibly damaging Het
Try10 T A 6: 41,332,523 (GRCm39) S60T probably benign Het
Usp31 A T 7: 121,247,499 (GRCm39) S1315T possibly damaging Het
Xrn2 A G 2: 146,905,262 (GRCm39) I856V probably benign Het
Other mutations in Acot10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Acot10 APN 15 20,666,051 (GRCm39) missense probably benign 0.11
IGL01610:Acot10 APN 15 20,665,781 (GRCm39) missense probably damaging 1.00
IGL02457:Acot10 APN 15 20,666,229 (GRCm39) missense possibly damaging 0.88
IGL02587:Acot10 APN 15 20,665,883 (GRCm39) missense possibly damaging 0.93
IGL02951:Acot10 APN 15 20,665,868 (GRCm39) missense probably benign 0.36
ANU23:Acot10 UTSW 15 20,666,051 (GRCm39) missense probably benign 0.11
PIT4151001:Acot10 UTSW 15 20,666,684 (GRCm39) missense probably damaging 0.98
R0026:Acot10 UTSW 15 20,666,322 (GRCm39) missense probably benign 0.10
R0026:Acot10 UTSW 15 20,666,322 (GRCm39) missense probably benign 0.10
R0462:Acot10 UTSW 15 20,666,712 (GRCm39) missense possibly damaging 0.85
R1312:Acot10 UTSW 15 20,666,585 (GRCm39) missense probably benign 0.00
R1495:Acot10 UTSW 15 20,665,593 (GRCm39) missense probably damaging 0.99
R2128:Acot10 UTSW 15 20,666,712 (GRCm39) missense probably benign 0.00
R3779:Acot10 UTSW 15 20,665,628 (GRCm39) missense probably damaging 0.98
R4110:Acot10 UTSW 15 20,666,612 (GRCm39) missense probably damaging 1.00
R4111:Acot10 UTSW 15 20,666,612 (GRCm39) missense probably damaging 1.00
R4464:Acot10 UTSW 15 20,665,830 (GRCm39) nonsense probably null
R4668:Acot10 UTSW 15 20,666,028 (GRCm39) missense probably benign
R4933:Acot10 UTSW 15 20,666,416 (GRCm39) missense possibly damaging 0.88
R5255:Acot10 UTSW 15 20,666,018 (GRCm39) missense probably benign 0.01
R5885:Acot10 UTSW 15 20,666,190 (GRCm39) missense probably benign 0.01
R6190:Acot10 UTSW 15 20,665,871 (GRCm39) missense possibly damaging 0.80
R6805:Acot10 UTSW 15 20,665,452 (GRCm39) missense probably benign 0.42
R7334:Acot10 UTSW 15 20,665,629 (GRCm39) missense possibly damaging 0.86
R7601:Acot10 UTSW 15 20,665,715 (GRCm39) missense probably damaging 1.00
R8400:Acot10 UTSW 15 20,666,258 (GRCm39) missense possibly damaging 0.56
R9195:Acot10 UTSW 15 20,665,517 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTTGAGCCACCATTACAAAGG -3'
(R):5'- AGAAAGTCCTACCACCGAGG -3'

Sequencing Primer
(F):5'- AGGCCAATATGTCTCATCATCGTG -3'
(R):5'- GTCCTACCACCGAGGAAAATAAGG -3'
Posted On 2018-04-02