Incidental Mutation 'R6301:Gm884'
ID509115
Institutional Source Beutler Lab
Gene Symbol Gm884
Ensembl Gene ENSMUSG00000034239
Gene Namepredicted gene 884
SynonymsLOC380730
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R6301 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location103534577-103621140 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 103618930 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059279] [ENSMUST00000167262]
Predicted Effect unknown
Transcript: ENSMUST00000059279
AA Change: H737Q
SMART Domains Protein: ENSMUSP00000058511
Gene: ENSMUSG00000034239
AA Change: H737Q

DomainStartEndE-ValueType
Pfam:LRRC37 149 223 5.4e-10 PFAM
low complexity region 244 264 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
Pfam:LRRC37 335 403 1.9e-14 PFAM
Pfam:LRRC37 419 514 1.2e-8 PFAM
Pfam:LRRC37 565 620 2e-10 PFAM
Pfam:LRRC37 669 739 7.6e-18 PFAM
Pfam:LRRC37 741 792 1.6e-9 PFAM
Pfam:LRRC37 789 860 1.4e-23 PFAM
Pfam:LRRC37 861 914 2.8e-9 PFAM
Pfam:LRRC37 911 983 1.9e-23 PFAM
Pfam:LRRC37 979 1038 1e-8 PFAM
Pfam:LRRC37 1034 1105 2.7e-24 PFAM
Pfam:LRRC37 1105 1158 2.3e-9 PFAM
Pfam:LRRC37 1155 1219 2.4e-17 PFAM
Pfam:LRRC37 1222 1265 9.2e-7 PFAM
Pfam:LRRC37 1263 1330 4.9e-24 PFAM
Pfam:LRRC37 1331 1384 1.4e-10 PFAM
Pfam:LRRC37 1380 1451 4.3e-15 PFAM
Pfam:LRRC37 1487 1558 1.9e-15 PFAM
Pfam:LRRC37 1594 1665 2.9e-18 PFAM
Pfam:LRRC37 1701 1772 5.6e-23 PFAM
Pfam:LRRC37 1808 1910 2.8e-18 PFAM
Pfam:LRRC37 1915 1986 7.2e-17 PFAM
Pfam:LRRC37 2022 2093 4.9e-22 PFAM
Pfam:LRRC37 2129 2200 4.4e-22 PFAM
Pfam:LRRC37 2236 2307 2.1e-21 PFAM
Pfam:LRRC37 2343 2414 3.8e-17 PFAM
Pfam:LRRC37 2449 2519 1.6e-19 PFAM
LRR 2777 2796 3.09e1 SMART
LRR_TYP 2797 2820 2.09e-3 SMART
LRR 2821 2844 4.44e0 SMART
LRR 2848 2872 8.26e1 SMART
low complexity region 2991 3002 N/A INTRINSIC
low complexity region 3220 3230 N/A INTRINSIC
low complexity region 3382 3393 N/A INTRINSIC
Pfam:LRRC37AB_C 3424 3570 7.7e-76 PFAM
low complexity region 3571 3589 N/A INTRINSIC
low complexity region 3622 3640 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167262
SMART Domains Protein: ENSMUSP00000129662
Gene: ENSMUSG00000034239

DomainStartEndE-ValueType
internal_repeat_1 1 70 1.46e-11 PROSPERO
internal_repeat_1 108 290 1.46e-11 PROSPERO
LRR 601 620 3.09e1 SMART
LRR_TYP 621 644 2.09e-3 SMART
LRR 645 668 4.44e0 SMART
LRR 672 696 8.26e1 SMART
low complexity region 815 826 N/A INTRINSIC
low complexity region 1044 1054 N/A INTRINSIC
low complexity region 1206 1217 N/A INTRINSIC
Pfam:LRRC37AB_C 1243 1396 1.2e-92 PFAM
low complexity region 1446 1464 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot10 T C 15: 20,666,262 N131S probably benign Het
Agbl5 A G 5: 30,891,833 Y220C probably damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Ap3b1 A T 13: 94,528,295 Q914L unknown Het
Arhgef25 T C 10: 127,185,882 D216G possibly damaging Het
Bcas2 T A 3: 103,171,871 probably benign Het
Bpifb5 A C 2: 154,230,219 H282P possibly damaging Het
Ccdc167 A G 17: 29,705,582 I15T probably damaging Het
Cd248 A G 19: 5,069,981 N619S probably benign Het
Chrna1 A G 2: 73,570,484 F234S possibly damaging Het
Clcc1 T G 3: 108,673,366 M332R probably damaging Het
Cmklr1 T A 5: 113,614,938 M1L possibly damaging Het
Cntnap5c A G 17: 57,892,037 M109V probably benign Het
Coq2 A G 5: 100,661,863 I18T possibly damaging Het
Crybg3 T C 16: 59,530,338 S880G probably damaging Het
Cubn A G 2: 13,478,078 C286R probably damaging Het
Defa24 T C 8: 21,735,283 V63A probably benign Het
Dnah6 C T 6: 73,086,217 R2634H probably damaging Het
Dusp8 T A 7: 142,083,019 probably null Het
Elac1 T C 18: 73,738,868 D352G probably damaging Het
Ermap A T 4: 119,185,603 V241E probably damaging Het
Fgf10 T A 13: 118,715,511 M43K probably benign Het
Gabrd A G 4: 155,387,267 V193A probably damaging Het
Gm13124 C T 4: 144,558,654 A138T probably damaging Het
Gm6588 A T 5: 112,450,468 I294F possibly damaging Het
Hectd4 T G 5: 121,254,220 C182W possibly damaging Het
Hook3 C T 8: 26,034,940 W26* probably null Het
Kif1a C A 1: 93,054,941 E714* probably null Het
Krt6b T C 15: 101,678,951 E236G probably damaging Het
Large2 A G 2: 92,369,516 L209P probably damaging Het
Lats1 A G 10: 7,703,107 N665S probably benign Het
Lrrtm3 T C 10: 64,089,222 I55M probably benign Het
Ltk A G 2: 119,751,757 S838P probably damaging Het
Ltn1 T C 16: 87,420,306 I348V probably benign Het
Mag T A 7: 30,900,679 S559C probably damaging Het
Mink1 A G 11: 70,612,294 H1072R possibly damaging Het
Mycbp2 T A 14: 103,155,426 Q833L probably damaging Het
Myh4 G A 11: 67,255,333 E1406K possibly damaging Het
Npc1 C T 18: 12,197,245 V950I probably benign Het
Npl A G 1: 153,518,881 probably null Het
Olfr1493-ps1 A G 19: 13,726,389 I43V probably benign Het
Olfr165 A T 16: 19,407,417 F200I possibly damaging Het
Olfr743 T A 14: 50,534,254 F281I probably benign Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Oxsm A T 14: 16,242,220 I183N probably damaging Het
Pde7a T C 3: 19,243,163 I108V probably benign Het
Pgghg A T 7: 140,946,376 T585S probably damaging Het
Pkhd1l1 G A 15: 44,589,525 D3949N probably damaging Het
Ralgapa2 A T 2: 146,327,411 H1777Q possibly damaging Het
Rela G A 19: 5,645,410 probably null Het
Rilpl1 C A 5: 124,514,539 G41W probably damaging Het
Rp1 T C 1: 4,347,254 K1212E probably benign Het
Sgca A C 11: 94,972,567 L28V probably damaging Het
Ssmem1 A G 6: 30,519,759 R148G probably damaging Het
St8sia5 A T 18: 77,246,140 N165Y probably damaging Het
Tbl2 A T 5: 135,159,369 H339L probably benign Het
Tcof1 G A 18: 60,828,825 P718L probably damaging Het
Trim72 A T 7: 128,004,614 E44V possibly damaging Het
Try10 T A 6: 41,355,589 S60T probably benign Het
Usp31 A T 7: 121,648,276 S1315T possibly damaging Het
Xrn2 A G 2: 147,063,342 I856V probably benign Het
Other mutations in Gm884
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Gm884 APN 11 103615410 missense probably benign 0.01
IGL00576:Gm884 APN 11 103617386 unclassified probably benign
IGL00813:Gm884 APN 11 103614498 missense probably benign 0.05
IGL01311:Gm884 APN 11 103534676 missense unknown
IGL01946:Gm884 APN 11 103612933 missense probably benign 0.28
IGL02217:Gm884 APN 11 103612871 splice site probably benign
IGL02556:Gm884 APN 11 103613283 missense probably benign 0.01
IGL02825:Gm884 APN 11 103617068 unclassified probably benign
IGL02868:Gm884 APN 11 103615139 missense probably benign 0.10
IGL02904:Gm884 APN 11 103616361 unclassified probably benign
IGL03008:Gm884 APN 11 103620467 missense unknown
IGL03120:Gm884 APN 11 103616975 unclassified probably benign
IGL03159:Gm884 APN 11 103604502 splice site probably benign
IGL03181:Gm884 APN 11 103616416 unclassified probably benign
IGL03202:Gm884 APN 11 103615373 missense probably benign 0.03
IGL03263:Gm884 APN 11 103613699 missense possibly damaging 0.86
PIT4486001:Gm884 UTSW 11 103618201 missense unknown
R0040:Gm884 UTSW 11 103542990 missense probably damaging 0.99
R0135:Gm884 UTSW 11 103618047 unclassified probably benign
R0141:Gm884 UTSW 11 103613686 missense probably damaging 1.00
R0226:Gm884 UTSW 11 103603241 missense probably benign 0.08
R0547:Gm884 UTSW 11 103620164 missense unknown
R0646:Gm884 UTSW 11 103613160 nonsense probably null
R0685:Gm884 UTSW 11 103616888 unclassified probably benign
R0732:Gm884 UTSW 11 103619838 missense unknown
R1015:Gm884 UTSW 11 103545796 missense probably benign 0.01
R1166:Gm884 UTSW 11 103615383 missense probably benign 0.21
R1168:Gm884 UTSW 11 103618950 unclassified probably benign
R1257:Gm884 UTSW 11 103534641 missense unknown
R1545:Gm884 UTSW 11 103608919 missense probably benign 0.16
R1570:Gm884 UTSW 11 103609938 missense possibly damaging 0.76
R1677:Gm884 UTSW 11 103614942 missense probably benign 0.19
R1703:Gm884 UTSW 11 103540874 missense probably benign 0.39
R1719:Gm884 UTSW 11 103617071 unclassified probably benign
R1752:Gm884 UTSW 11 103614555 missense possibly damaging 0.67
R1870:Gm884 UTSW 11 103620605 missense unknown
R2155:Gm884 UTSW 11 103620459 missense unknown
R2191:Gm884 UTSW 11 103618967 unclassified probably benign
R2271:Gm884 UTSW 11 103614207 missense possibly damaging 0.53
R2378:Gm884 UTSW 11 103619711 unclassified probably benign
R2405:Gm884 UTSW 11 103620984 missense unknown
R2864:Gm884 UTSW 11 103540918 missense probably benign 0.34
R3011:Gm884 UTSW 11 103613103 missense possibly damaging 0.62
R3415:Gm884 UTSW 11 103614609 missense possibly damaging 0.82
R3417:Gm884 UTSW 11 103614609 missense possibly damaging 0.82
R3835:Gm884 UTSW 11 103620010 missense unknown
R3974:Gm884 UTSW 11 103619101 unclassified probably benign
R4019:Gm884 UTSW 11 103615293 missense probably benign 0.19
R4020:Gm884 UTSW 11 103615293 missense probably benign 0.19
R4176:Gm884 UTSW 11 103536600 missense unknown
R4361:Gm884 UTSW 11 103617501 frame shift probably null
R4418:Gm884 UTSW 11 103618314 unclassified probably benign
R4633:Gm884 UTSW 11 103619131 unclassified probably benign
R4693:Gm884 UTSW 11 103619860 missense unknown
R4758:Gm884 UTSW 11 103614464 missense possibly damaging 0.48
R4878:Gm884 UTSW 11 103617891 unclassified probably benign
R4887:Gm884 UTSW 11 103614872 missense probably benign 0.03
R4944:Gm884 UTSW 11 103613460 missense possibly damaging 0.68
R4952:Gm884 UTSW 11 103614207 missense possibly damaging 0.53
R5030:Gm884 UTSW 11 103534849 missense unknown
R5183:Gm884 UTSW 11 103543121 missense probably damaging 0.99
R5294:Gm884 UTSW 11 103616231 unclassified probably benign
R5317:Gm884 UTSW 11 103614145 missense possibly damaging 0.73
R5334:Gm884 UTSW 11 103613873 missense probably benign 0.18
R5426:Gm884 UTSW 11 103620760 missense unknown
R5467:Gm884 UTSW 11 103603265 nonsense probably null
R5518:Gm884 UTSW 11 103615253 missense probably benign 0.03
R5634:Gm884 UTSW 11 103542014 missense possibly damaging 0.95
R5647:Gm884 UTSW 11 103617474 unclassified probably benign
R5663:Gm884 UTSW 11 103613123 missense probably benign 0.01
R5668:Gm884 UTSW 11 103617054 unclassified probably benign
R5763:Gm884 UTSW 11 103613643 missense probably damaging 0.97
R5829:Gm884 UTSW 11 103541886 missense possibly damaging 0.95
R5871:Gm884 UTSW 11 103616454 unclassified probably benign
R5905:Gm884 UTSW 11 103614255 missense probably damaging 0.98
R5940:Gm884 UTSW 11 103613886 missense probably benign 0.18
R5964:Gm884 UTSW 11 103542120 missense possibly damaging 0.92
R5988:Gm884 UTSW 11 103615896 unclassified probably benign
R5992:Gm884 UTSW 11 103613792 missense possibly damaging 0.81
R6114:Gm884 UTSW 11 103617791 unclassified probably benign
R6154:Gm884 UTSW 11 103614143 missense probably benign 0.33
R6233:Gm884 UTSW 11 103613388 missense probably damaging 0.98
R6362:Gm884 UTSW 11 103620652 missense unknown
R6471:Gm884 UTSW 11 103619622 unclassified probably benign
R6806:Gm884 UTSW 11 103621124 missense unknown
R6962:Gm884 UTSW 11 103614300 missense possibly damaging 0.67
R6996:Gm884 UTSW 11 103618757 nonsense probably null
R7028:Gm884 UTSW 11 103614537 missense probably benign 0.28
R7034:Gm884 UTSW 11 103615812 unclassified probably benign
R7036:Gm884 UTSW 11 103615812 unclassified probably benign
R7113:Gm884 UTSW 11 103618799 missense unknown
R7405:Gm884 UTSW 11 103615161 missense probably benign 0.02
R7420:Gm884 UTSW 11 103613625 missense probably benign 0.11
R7461:Gm884 UTSW 11 103616290 missense unknown
R7544:Gm884 UTSW 11 103615448 missense probably benign 0.01
R7613:Gm884 UTSW 11 103616290 missense unknown
R7711:Gm884 UTSW 11 103614912 missense probably benign 0.02
R7714:Gm884 UTSW 11 103616893 missense unknown
R7747:Gm884 UTSW 11 103614255 missense probably damaging 0.98
R7814:Gm884 UTSW 11 103614173 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- TGGTCTCCTGCAAAGTTTGAG -3'
(R):5'- TTTAAAACCTCCTAGGGTGGGG -3'

Sequencing Primer
(F):5'- GTCTCCTGCAAAGTTTGAGCAAAG -3'
(R):5'- AAACCTCCTAGGGTGGGGAATTTTTC -3'
Posted On2018-04-02