Incidental Mutation 'R3757:Cdh24'
ID271495
Institutional Source Beutler Lab
Gene Symbol Cdh24
Ensembl Gene ENSMUSG00000059674
Gene Namecadherin-like 24
SynonymsEY-cadherin, cadherin 14-like, 1700040A22Rik, ENSMUSG00000022188
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #R3757 (G1)
Quality Score107
Status Validated
Chromosome14
Chromosomal Location54631231-54641364 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54632180 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 760 (D760G)
Ref Sequence ENSEMBL: ENSMUSP00000066005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067784] [ENSMUST00000097177] [ENSMUST00000227124]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067784
AA Change: D760G

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000066005
Gene: ENSMUSG00000059674
AA Change: D760G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 67 148 7.85e-18 SMART
CA 172 257 3.23e-28 SMART
CA 281 369 4.24e-14 SMART
CA 396 477 1.48e-22 SMART
Blast:CA 500 581 3e-31 BLAST
transmembrane domain 602 624 N/A INTRINSIC
Pfam:Cadherin_C 627 775 2e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097177
SMART Domains Protein: ENSMUSP00000132140
Gene: ENSMUSG00000072423

DomainStartEndE-ValueType
Pfam:Proteasome 46 228 3.9e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227124
Meta Mutation Damage Score 0.1465 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 92% (35/38)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl3 T A 7: 82,337,207 I9K probably benign Het
Arhgap31 T C 16: 38,637,000 E82G probably damaging Het
Asap2 T A 12: 21,267,766 S993T probably damaging Het
Bmpr1a A T 14: 34,434,667 L134* probably null Het
Cacna1e A G 1: 154,633,696 V271A probably damaging Het
Cacna2d4 A G 6: 119,241,163 E153G probably damaging Het
Cage1 A C 13: 38,025,729 F91V possibly damaging Het
Col9a1 T C 1: 24,232,231 probably null Het
Cts6 A T 13: 61,202,158 Y36* probably null Het
Dennd3 C G 15: 73,522,234 A36G probably benign Het
Dmxl1 G A 18: 49,935,317 G2719D probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Ep300 T A 15: 81,648,589 V1676E unknown Het
Ercc4 C T 16: 13,144,496 T668M probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gm10985 GCTCTCTCTCTCTCTCTCTCTCTCTCTCT GCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT 3: 53,845,224 probably null Het
Havcr1 G T 11: 46,752,580 R109L probably damaging Het
Hist1h1e T A 13: 23,622,257 K81* probably null Het
Krtap4-9 A G 11: 99,785,618 probably benign Het
Layn T C 9: 51,059,556 E229G probably benign Het
Lpcat3 T A 6: 124,699,992 probably null Het
Lrrn1 T A 6: 107,569,208 F656I possibly damaging Het
Lypd1 A G 1: 125,910,384 probably benign Het
Olfr111 T A 17: 37,530,355 I126N probably damaging Het
Olfr1287 T A 2: 111,449,257 V39E possibly damaging Het
Olfr777 T C 10: 129,269,065 D86G probably damaging Het
Ptprt A T 2: 161,812,030 L560Q probably damaging Het
Rbm11 T C 16: 75,596,581 V55A probably damaging Het
Scn11a C T 9: 119,803,503 V434I probably benign Het
Serpinc1 A G 1: 161,002,365 T434A probably benign Het
Setd2 T C 9: 110,573,685 I1798T probably damaging Het
Sfswap A G 5: 129,513,234 Y265C probably damaging Het
Slc9a8 C A 2: 167,424,130 T9K probably benign Het
Synpo T C 18: 60,602,990 D389G probably damaging Het
Vmn1r181 C T 7: 23,984,484 L125F possibly damaging Het
Wdfy4 A C 14: 33,023,374 H2296Q probably benign Het
Other mutations in Cdh24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Cdh24 APN 14 54638432 missense probably benign 0.01
IGL02597:Cdh24 APN 14 54633515 missense possibly damaging 0.55
R0088:Cdh24 UTSW 14 54633714 missense probably damaging 1.00
R0480:Cdh24 UTSW 14 54632597 missense probably benign 0.38
R0890:Cdh24 UTSW 14 54632594 missense probably benign 0.00
R1525:Cdh24 UTSW 14 54638589 missense probably damaging 1.00
R1591:Cdh24 UTSW 14 54636342 missense probably benign 0.19
R1727:Cdh24 UTSW 14 54638638 nonsense probably null
R4786:Cdh24 UTSW 14 54637550 missense possibly damaging 0.65
R4921:Cdh24 UTSW 14 54633215 missense probably damaging 1.00
R4929:Cdh24 UTSW 14 54633516 missense probably benign 0.00
R5116:Cdh24 UTSW 14 54636413 missense probably benign 0.34
R5589:Cdh24 UTSW 14 54637375 missense probably damaging 1.00
R5682:Cdh24 UTSW 14 54637348 missense probably damaging 1.00
R5774:Cdh24 UTSW 14 54639057 missense probably damaging 0.99
R6305:Cdh24 UTSW 14 54632356 missense possibly damaging 0.62
R7090:Cdh24 UTSW 14 54639507 missense probably damaging 1.00
R7186:Cdh24 UTSW 14 54633492 missense probably benign 0.03
R7361:Cdh24 UTSW 14 54638921 missense possibly damaging 0.74
R7488:Cdh24 UTSW 14 54632180 missense possibly damaging 0.92
R7623:Cdh24 UTSW 14 54638090 missense probably damaging 1.00
R7823:Cdh24 UTSW 14 54637418 missense probably damaging 1.00
R7973:Cdh24 UTSW 14 54639020 missense possibly damaging 0.87
R8017:Cdh24 UTSW 14 54638632 missense probably damaging 1.00
R8019:Cdh24 UTSW 14 54638632 missense probably damaging 1.00
R8029:Cdh24 UTSW 14 54639399 missense probably damaging 1.00
R8070:Cdh24 UTSW 14 54632573 missense probably benign
R8160:Cdh24 UTSW 14 54638489 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGGAGGGTCATATTGGGCC -3'
(R):5'- CCTTCGACATCACAGCCTTG -3'

Sequencing Primer
(F):5'- TCATATTGGGCCCCTGGG -3'
(R):5'- CTTGCAGAACCCGGATGGAG -3'
Posted On2015-03-18