Incidental Mutation 'R6318:Brd2'
ID510318
Institutional Source Beutler Lab
Gene Symbol Brd2
Ensembl Gene ENSMUSG00000024335
Gene Namebromodomain containing 2
SynonymsFrg-1, Fsrg1, D17H6S113E, Ring3, Rnf3
MMRRC Submission
Accession Numbers

Genbank: NM_010238, NM_001025387; MGI: 99495

 

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6318 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location34112023-34122634 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 34112898 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 349 (V349F)
Ref Sequence ENSEMBL: ENSMUSP00000092990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025193] [ENSMUST00000095347] [ENSMUST00000114242] [ENSMUST00000151986] [ENSMUST00000154232]
Predicted Effect probably damaging
Transcript: ENSMUST00000025193
AA Change: V741F

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000025193
Gene: ENSMUSG00000024335
AA Change: V741F

DomainStartEndE-ValueType
low complexity region 10 29 N/A INTRINSIC
BROMO 71 181 2.13e-43 SMART
low complexity region 256 276 N/A INTRINSIC
low complexity region 284 290 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
BROMO 345 454 1.13e-47 SMART
coiled coil region 486 537 N/A INTRINSIC
low complexity region 542 560 N/A INTRINSIC
low complexity region 583 593 N/A INTRINSIC
PDB:2JNS|A 635 712 3e-37 PDB
coiled coil region 721 750 N/A INTRINSIC
low complexity region 772 797 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000095347
AA Change: V349F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092990
Gene: ENSMUSG00000024335
AA Change: V349F

DomainStartEndE-ValueType
BROMO 25 135 1.3e-45 SMART
low complexity region 210 230 N/A INTRINSIC
low complexity region 238 244 N/A INTRINSIC
low complexity region 248 258 N/A INTRINSIC
BROMO 299 408 6.8e-50 SMART
coiled coil region 440 491 N/A INTRINSIC
low complexity region 496 514 N/A INTRINSIC
low complexity region 537 547 N/A INTRINSIC
PDB:2JNS|A 589 666 2e-37 PDB
coiled coil region 675 704 N/A INTRINSIC
low complexity region 726 751 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114242
AA Change: V741F

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109880
Gene: ENSMUSG00000024335
AA Change: V741F

DomainStartEndE-ValueType
low complexity region 10 29 N/A INTRINSIC
BROMO 71 181 2.13e-43 SMART
low complexity region 256 276 N/A INTRINSIC
low complexity region 284 290 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
BROMO 345 454 1.13e-47 SMART
coiled coil region 486 537 N/A INTRINSIC
low complexity region 542 560 N/A INTRINSIC
low complexity region 583 593 N/A INTRINSIC
Pfam:BET 639 703 7.4e-35 PFAM
coiled coil region 721 750 N/A INTRINSIC
low complexity region 772 797 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142570
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148143
Predicted Effect probably benign
Transcript: ENSMUST00000151986
SMART Domains Protein: ENSMUSP00000117359
Gene: ENSMUSG00000024335

DomainStartEndE-ValueType
low complexity region 10 29 N/A INTRINSIC
BROMO 71 181 2.13e-43 SMART
low complexity region 256 276 N/A INTRINSIC
low complexity region 284 290 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
BROMO 345 454 1.13e-47 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154232
SMART Domains Protein: ENSMUSP00000128835
Gene: ENSMUSG00000024335

DomainStartEndE-ValueType
low complexity region 10 29 N/A INTRINSIC
low complexity region 50 71 N/A INTRINSIC
Blast:BROMO 72 110 4e-21 BLAST
PDB:3AQA|C 72 110 2e-22 PDB
SCOP:d1f68a_ 76 103 1e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155286
Predicted Effect probably benign
Transcript: ENSMUST00000173032
SMART Domains Protein: ENSMUSP00000134608
Gene: ENSMUSG00000024335

DomainStartEndE-ValueType
Pfam:Bromodomain 1 43 1.4e-6 PFAM
coiled coil region 73 124 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173204
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.3%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional regulator that belongs to the BET (bromodomains and extra terminal domain) family of proteins. This protein associates with transcription complexes and with acetylated chromatin during mitosis, and it selectively binds to the acetylated lysine-12 residue of histone H4 via its two bromodomains. The gene maps to the major histocompatability complex (MHC) class II region on chromosome 6p21.3, but sequence comparison suggests that the protein is not involved in the immune response. This gene has been implicated in juvenile myoclonic epilepsy, a common form of epilepsy that becomes apparent in adolescence. Multiple alternatively spliced variants have been described for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis with decreased embryo size, decreased cell proliferation, a delay in the cell cycle, and increased cell death. Heterozygous mice also display decreased cell proliferation. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted, other(2) Gene trapped(14)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A G 9: 108,393,275 T13A possibly damaging Het
Abcg4 T C 9: 44,275,348 T500A probably benign Het
Adcy4 T A 14: 55,769,224 I1051F probably damaging Het
Adgrg6 A T 10: 14,467,497 N235K probably benign Het
Aldh3a2 A C 11: 61,262,419 Y160* probably null Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Armt1 T C 10: 4,450,859 M202T probably benign Het
AU019823 T C 9: 50,607,461 R284G probably benign Het
Btnl10 A T 11: 58,926,865 probably benign Het
Ccdc178 A G 18: 22,120,534 V216A possibly damaging Het
Ccdc85c A T 12: 108,274,709 L142Q unknown Het
Cdc27 A T 11: 104,528,694 S172T probably damaging Het
Ceacam14 T C 7: 17,814,312 I109T probably damaging Het
Ces5a C T 8: 93,534,583 G72E probably damaging Het
Cfb A G 17: 34,861,824 Y66H possibly damaging Het
Clec14a G A 12: 58,268,215 P207L probably damaging Het
Clec16a G A 16: 10,630,788 R599H probably damaging Het
Csmd1 A T 8: 15,903,212 I3423N probably damaging Het
Cyp4a29 C A 4: 115,250,199 N243K probably benign Het
Ddx59 T C 1: 136,416,872 F94L probably damaging Het
Dusp3 A C 11: 101,986,871 V19G probably benign Het
Fat3 T C 9: 15,916,984 probably benign Het
Fgfr4 T A 13: 55,166,108 V545E probably damaging Het
Fxn G T 19: 24,280,426 A47D probably damaging Het
Gdpgp1 A T 7: 80,239,150 I310F possibly damaging Het
Gm7210 A T 7: 11,594,113 noncoding transcript Het
Grm7 G T 6: 111,358,875 C749F probably damaging Het
Hps4 T G 5: 112,346,629 V26G probably damaging Het
Igf1r A G 7: 68,165,233 D294G probably benign Het
Immp1l T C 2: 105,930,827 F27S probably benign Het
Kcnk3 T A 5: 30,622,586 C327S probably damaging Het
Kif13a T A 13: 46,815,207 probably null Het
Krtap5-4 T C 7: 142,304,090 S166P unknown Het
Lyst G A 13: 13,743,311 D3319N possibly damaging Het
Malrd1 T G 2: 16,042,267 S1735A unknown Het
Myh4 A G 11: 67,243,442 T308A probably benign Het
Myh8 A T 11: 67,299,341 Q1269L probably benign Het
Myo15b G A 11: 115,890,831 V1367I probably damaging Het
Nae1 T C 8: 104,523,637 D208G probably benign Het
Nelfe T A 17: 34,854,456 V296D probably damaging Het
Npepps A T 11: 97,218,548 V734E probably damaging Het
Ogdh A G 11: 6,349,390 N752S probably damaging Het
Olfr1094 A G 2: 86,829,654 I301V possibly damaging Het
Olfr266 T C 3: 106,822,187 D124G probably damaging Het
Olfr401 A T 11: 74,121,721 Q144L possibly damaging Het
Olfr906 T C 9: 38,488,377 M116T probably benign Het
Otof C A 5: 30,414,544 G171V probably damaging Het
Phtf2 A T 5: 20,801,941 V208D probably damaging Het
Pkn1 T A 8: 83,683,591 T340S probably damaging Het
Plcd4 C T 1: 74,563,594 L668F possibly damaging Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Prss50 A T 9: 110,861,299 D170V probably damaging Het
Ptprg T C 14: 12,237,118 V604A probably damaging Het
Rab33b T C 3: 51,493,405 V100A probably damaging Het
Rbm26 T A 14: 105,131,535 D736V probably damaging Het
Rela C A 19: 5,646,964 P400T probably benign Het
Rpusd4 T C 9: 35,268,038 L50P probably damaging Het
Scn10a A C 9: 119,627,115 Y1214D probably damaging Het
Sema3c A G 5: 17,672,432 E179G probably damaging Het
Skint5 T A 4: 113,517,133 D1253V unknown Het
Sp4 G T 12: 118,238,178 P771H probably damaging Het
Sphkap T A 1: 83,278,378 Y263F probably damaging Het
Ssbp1 G A 6: 40,476,753 V78I probably benign Het
St3gal6 A G 16: 58,486,406 I87T probably benign Het
Tango6 T A 8: 106,818,497 D997E probably benign Het
Tpr C T 1: 150,445,888 P2265S possibly damaging Het
Ttc7b A T 12: 100,325,677 F212Y probably damaging Het
Ubc A G 5: 125,388,260 M1T probably null Het
Vill G C 9: 119,063,648 Q376H probably benign Het
Yes1 T C 5: 32,651,686 I132T possibly damaging Het
Ythdc2 A G 18: 44,860,377 T830A probably benign Het
Zbtb41 T A 1: 139,430,306 F451I possibly damaging Het
Zfp995 C T 17: 21,880,512 C247Y probably benign Het
Other mutations in Brd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Brd2 APN 17 34114423 missense probably damaging 1.00
IGL01589:Brd2 APN 17 34117042 missense probably damaging 1.00
IGL01724:Brd2 APN 17 34117002 missense probably damaging 1.00
IGL01724:Brd2 APN 17 34117001 missense probably damaging 1.00
IGL02043:Brd2 APN 17 34112616 unclassified probably benign
crater UTSW 17 34113259 missense probably damaging 0.96
FR4449:Brd2 UTSW 17 34116336 unclassified probably benign
FR4548:Brd2 UTSW 17 34116336 unclassified probably benign
R0085:Brd2 UTSW 17 34113259 missense probably damaging 0.96
R0497:Brd2 UTSW 17 34114360 missense probably damaging 1.00
R0879:Brd2 UTSW 17 34113446 missense probably benign 0.03
R1150:Brd2 UTSW 17 34114007 utr 3 prime probably benign
R1152:Brd2 UTSW 17 34114007 utr 3 prime probably benign
R1280:Brd2 UTSW 17 34114150 missense possibly damaging 0.91
R1426:Brd2 UTSW 17 34114007 utr 3 prime probably benign
R2247:Brd2 UTSW 17 34114415 missense probably damaging 1.00
R3737:Brd2 UTSW 17 34117080 missense probably benign 0.10
R5286:Brd2 UTSW 17 34115231 missense probably damaging 0.97
R5673:Brd2 UTSW 17 34112607 unclassified probably benign
R6134:Brd2 UTSW 17 34113695 missense probably benign 0.00
R7257:Brd2 UTSW 17 34113822 missense probably damaging 1.00
R7493:Brd2 UTSW 17 34122257 unclassified probably benign
R7888:Brd2 UTSW 17 34117021 missense probably damaging 1.00
R7971:Brd2 UTSW 17 34117021 missense probably damaging 1.00
Z1176:Brd2 UTSW 17 34113688 missense possibly damaging 0.94
Z1177:Brd2 UTSW 17 34116907 critical splice donor site probably null
Z1177:Brd2 UTSW 17 34116908 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ACTTGCTGTGCAGATGACTC -3'
(R):5'- AGCAGCATCCAGGATGACTG -3'

Sequencing Primer
(F):5'- CTCACTCGCTGTAAAGTTAAAGG -3'
(R):5'- ACTGGGCTGCTTCAGGAATG -3'
Posted On2018-04-02