Incidental Mutation 'R6389:Clu'
ID515711
Institutional Source Beutler Lab
Gene Symbol Clu
Ensembl Gene ENSMUSG00000022037
Gene Nameclusterin
SynonymsD14Ucla3, Sgp-2, Sgp2, ApoJ, Cli, SP-40, Sugp-2, complement lysis inhibitor, Apolipoprotein J, testosterone repressed prostate message-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.326) question?
Stock #R6389 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location65968483-65981547 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to C at 65971322 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022616] [ENSMUST00000127387] [ENSMUST00000128539] [ENSMUST00000138191] [ENSMUST00000138665] [ENSMUST00000144619] [ENSMUST00000153460]
Predicted Effect probably benign
Transcript: ENSMUST00000022616
SMART Domains Protein: ENSMUSP00000022616
Gene: ENSMUSG00000022037

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CLb 22 226 9.93e-152 SMART
CLa 227 442 2.3e-156 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127387
SMART Domains Protein: ENSMUSP00000114720
Gene: ENSMUSG00000022037

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CLb 22 226 9.93e-152 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128539
SMART Domains Protein: ENSMUSP00000121485
Gene: ENSMUSG00000022037

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CLb 22 203 3.48e-124 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138191
SMART Domains Protein: ENSMUSP00000117555
Gene: ENSMUSG00000022037

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CLb 22 225 2.18e-148 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138665
Predicted Effect unknown
Transcript: ENSMUST00000144619
AA Change: R5S
SMART Domains Protein: ENSMUSP00000117953
Gene: ENSMUSG00000022037
AA Change: R5S

DomainStartEndE-ValueType
low complexity region 92 100 N/A INTRINSIC
CLb 110 209 1.16e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146990
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152903
Predicted Effect probably benign
Transcript: ENSMUST00000153460
SMART Domains Protein: ENSMUSP00000121633
Gene: ENSMUSG00000022037

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CLb 22 226 9.93e-152 SMART
Blast:CLa 227 265 2e-19 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.9%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: The protein encoded by this gene is a secreted chaperone that can, under some stress conditions, also be found in the cell cytosol. It has been suggested to be involved in several basic biological events such as cell death, tumor progression, and neurodegenerative disorders. The encoded preproprotein undergoes proteolytic processing to generate a disulfide-linked heterodimeric mature protein comprised of alpha and beta subunits. Mice lacking the encoded protein exhibit increased severity of autoimmune myocarditis, faster progression of the acute inflammation to myocardial scarring and decreased brain injury following neonatal hypoxic-ischemic injury. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous inactivation of this gene leads to progressive renal glomerulopathy and increased severity of myosin-induced autoimmune myocarditis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik A C 7: 43,497,830 L326R possibly damaging Het
5430403G16Rik G A 5: 109,676,019 P522S possibly damaging Het
Abcb11 A T 2: 69,323,894 N109K probably damaging Het
Actn1 T A 12: 80,174,522 M586L probably benign Het
Ago4 T A 4: 126,507,244 I603F probably damaging Het
Bicc1 A T 10: 70,958,922 V135D probably damaging Het
Bms1 T C 6: 118,403,235 N704D possibly damaging Het
Cadm4 A C 7: 24,499,534 Q78P probably benign Het
Ccdc114 G T 7: 45,948,516 V617F probably benign Het
Cfap74 T C 4: 155,423,336 I248T possibly damaging Het
Cnnm3 T C 1: 36,520,522 V514A probably damaging Het
Cntd1 A T 11: 101,285,751 I225F probably damaging Het
Col20a1 T C 2: 180,992,583 probably null Het
Ctnnal1 A G 4: 56,813,849 V640A probably benign Het
Cul4a A G 8: 13,140,278 T572A probably benign Het
D16Ertd472e A G 16: 78,545,183 S270P probably damaging Het
Dmp1 A T 5: 104,212,922 N488I probably damaging Het
Dnah14 G A 1: 181,651,202 probably null Het
Dst T C 1: 34,193,184 L3464P probably damaging Het
Fnbp4 C T 2: 90,745,535 P27S unknown Het
Fpr-rs3 A T 17: 20,623,968 F304I probably damaging Het
Gm13941 T C 2: 111,098,389 Q108R unknown Het
Hcn3 C T 3: 89,150,933 A339T possibly damaging Het
Inpp5f A G 7: 128,678,056 D460G probably damaging Het
Ism2 T C 12: 87,282,371 E253G possibly damaging Het
Klrg1 T C 6: 122,271,472 N156S probably damaging Het
Ksr2 A G 5: 117,414,842 N5S probably benign Het
Lrrc7 T G 3: 158,185,426 E368A probably damaging Het
Ly9 G C 1: 171,596,537 S482C probably damaging Het
Map3k1 T C 13: 111,769,441 D289G probably damaging Het
Mcub T C 3: 129,918,708 T173A probably benign Het
Mup16 T C 4: 61,518,940 E48G probably damaging Het
Naf1 C T 8: 66,861,028 S24L possibly damaging Het
Ncoa6 A G 2: 155,395,816 S2024P probably damaging Het
Nop56 C A 2: 130,277,887 Q83K probably damaging Het
Nt5e T C 9: 88,363,471 Y265H probably damaging Het
Olfr1151 C T 2: 87,858,023 P283S probably damaging Het
Olfr1197 A G 2: 88,728,672 V309A probably benign Het
Olfr551 A T 7: 102,588,472 N90K probably benign Het
Oxct2a T A 4: 123,323,427 K54* probably null Het
Oxct2b G T 4: 123,116,574 D96Y probably benign Het
Pisd A G 5: 32,764,847 Y250H probably damaging Het
Plekhm1 G T 11: 103,366,894 N1071K probably benign Het
Prr11 G A 11: 87,098,738 T269I possibly damaging Het
Ptpn4 T A 1: 119,721,954 H304L probably damaging Het
Rrp1b A G 17: 32,056,627 K383E possibly damaging Het
Sel1l2 C A 2: 140,245,354 A466S probably damaging Het
Slc9a4 A G 1: 40,580,684 I57V probably benign Het
Spag9 A G 11: 94,086,311 E81G probably damaging Het
Tbr1 A G 2: 61,806,287 probably benign Het
Tnrc6c A G 11: 117,722,741 D735G probably damaging Het
Tspan17 A T 13: 54,795,616 probably null Het
Tyw5 T C 1: 57,391,499 K175R probably damaging Het
Ube2o A C 11: 116,548,858 I162R probably null Het
Ubr1 G T 2: 120,881,039 T1458K probably benign Het
Vmn2r16 A T 5: 109,330,478 Q33L probably benign Het
Zfp799 A G 17: 32,820,578 L238P probably damaging Het
Other mutations in Clu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01339:Clu APN 14 65975588 missense probably damaging 0.98
IGL01657:Clu APN 14 65979672 missense possibly damaging 0.81
IGL02030:Clu APN 14 65975791 missense probably benign 0.08
IGL02891:Clu APN 14 65975984 missense probably damaging 0.96
IGL03163:Clu APN 14 65979786 missense probably benign 0.06
R1378:Clu UTSW 14 65974901 missense probably damaging 1.00
R1417:Clu UTSW 14 65974971 nonsense probably null
R1711:Clu UTSW 14 65980905 missense possibly damaging 0.63
R2134:Clu UTSW 14 65974841 critical splice acceptor site probably null
R2285:Clu UTSW 14 65980959 missense probably benign 0.03
R2340:Clu UTSW 14 65980909 missense probably damaging 0.99
R2508:Clu UTSW 14 65975003 missense probably damaging 1.00
R4700:Clu UTSW 14 65979864 missense probably benign 0.25
R4981:Clu UTSW 14 65973366 missense probably damaging 0.97
R5062:Clu UTSW 14 65979728 missense probably damaging 0.99
R5422:Clu UTSW 14 65975602 missense probably damaging 0.99
R7009:Clu UTSW 14 65971832 missense probably damaging 1.00
R8306:Clu UTSW 14 65979762 missense probably damaging 1.00
X0025:Clu UTSW 14 65971814 missense probably damaging 1.00
Z1088:Clu UTSW 14 65976913 missense probably benign 0.00
Z1177:Clu UTSW 14 65975921 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AATCCATACTCAGCCTGGTGG -3'
(R):5'- ACCCCTTCTATAGACACTGGAG -3'

Sequencing Primer
(F):5'- CTGGTGGCACAAGCGTTG -3'
(R):5'- TGGGAAGAACCATGGCCC -3'
Posted On2018-05-04