Incidental Mutation 'R6485:Stk11ip'
ID517289
Institutional Source Beutler Lab
Gene Symbol Stk11ip
Ensembl Gene ENSMUSG00000026213
Gene Nameserine/threonine kinase 11 interacting protein
Synonyms1200014D22Rik, LKB1IP, LIP1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6485 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location75521529-75537335 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75529968 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 605 (V605A)
Ref Sequence ENSEMBL: ENSMUSP00000109182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027414] [ENSMUST00000113553]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027414
AA Change: V605A

PolyPhen 2 Score 0.475 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000027414
Gene: ENSMUSG00000026213
AA Change: V605A

DomainStartEndE-ValueType
low complexity region 25 41 N/A INTRINSIC
SCOP:d1h6ua2 74 291 2e-19 SMART
Blast:LRR 208 231 2e-6 BLAST
Blast:LRR 253 276 5e-6 BLAST
Blast:LRR 278 304 2e-8 BLAST
low complexity region 376 386 N/A INTRINSIC
coiled coil region 495 528 N/A INTRINSIC
low complexity region 752 767 N/A INTRINSIC
low complexity region 948 959 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113553
AA Change: V605A

PolyPhen 2 Score 0.475 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000109182
Gene: ENSMUSG00000026213
AA Change: V605A

DomainStartEndE-ValueType
Pfam:LIP1 4 94 2.9e-45 PFAM
low complexity region 175 194 N/A INTRINSIC
Blast:LRR 208 231 2e-6 BLAST
Blast:LRR 253 276 5e-6 BLAST
Blast:LRR 278 304 2e-8 BLAST
low complexity region 376 386 N/A INTRINSIC
coiled coil region 495 528 N/A INTRINSIC
low complexity region 752 767 N/A INTRINSIC
low complexity region 948 959 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129652
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129794
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140963
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146575
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150560
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154303
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156838
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 C A 7: 120,427,167 Y117* probably null Het
Acot5 A T 12: 84,075,484 R281W probably damaging Het
Adamts20 T C 15: 94,343,971 T719A probably benign Het
Arhgap33 T C 7: 30,524,004 T867A probably benign Het
Bcl2a1c T C 9: 114,330,210 Y19H probably benign Het
Bod1l A G 5: 41,817,116 I2285T possibly damaging Het
Cacna2d1 A G 5: 16,354,657 Y755C probably damaging Het
Cdc27 T C 11: 104,505,648 T816A probably benign Het
Clasrp C A 7: 19,586,369 probably benign Het
Col6a4 A G 9: 106,076,870 probably null Het
Cpd T C 11: 76,808,707 probably null Het
Crispld2 A G 8: 120,029,309 D339G probably damaging Het
Dst A G 1: 34,294,529 D7046G probably damaging Het
Erbin G T 13: 103,868,113 Q136K probably damaging Het
Exph5 G A 9: 53,376,691 E1691K possibly damaging Het
Fads6 A G 11: 115,285,438 F187S probably benign Het
Foxg1 A T 12: 49,385,080 I199F probably damaging Het
Garem1 T C 18: 21,129,837 D640G probably benign Het
Gba2 A C 4: 43,574,118 Y112D probably damaging Het
Gcfc2 T C 6: 81,939,547 I323T probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gria4 T A 9: 4,464,249 Y571F probably damaging Het
Large2 T C 2: 92,366,028 T485A probably benign Het
Lonrf1 A G 8: 36,229,134 probably null Het
Mrgprb5 T C 7: 48,168,777 N70S probably damaging Het
Muc2 T A 7: 141,746,736 probably benign Het
Nol4 T C 18: 22,770,793 D375G probably damaging Het
Olfr1359 A G 13: 21,703,430 Q143R probably benign Het
Pcnt G T 10: 76,389,330 S1780* probably null Het
Pdgfra A T 5: 75,175,074 probably null Het
Pgd A T 4: 149,156,419 probably null Het
Pla2g6 T C 15: 79,307,372 I279V probably benign Het
Ptpn21 A T 12: 98,698,872 C297* probably null Het
Ripply1 TTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT TTCCTCCTCCTCCTCCTCCTCCTCCTCCT X: 139,779,850 probably benign Het
Rtcb T C 10: 85,957,644 I22V probably benign Het
Slc25a30 G T 14: 75,775,007 A67E probably damaging Het
Ush1c A T 7: 46,209,110 S585T probably benign Het
Vps13a T C 19: 16,680,050 D1785G probably damaging Het
Zic5 T A 14: 122,459,640 Y521F unknown Het
Other mutations in Stk11ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Stk11ip APN 1 75530266 missense probably damaging 1.00
IGL01776:Stk11ip APN 1 75527821 missense probably benign 0.02
IGL02752:Stk11ip APN 1 75524681 critical splice acceptor site probably null
IGL03132:Stk11ip APN 1 75536089 missense probably benign 0.00
IGL03188:Stk11ip APN 1 75534435 missense probably benign 0.00
R6768_Stk11ip_021 UTSW 1 75532635 missense probably benign
sienna UTSW 1 75527355 splice site probably null
R0234:Stk11ip UTSW 1 75529067 missense possibly damaging 0.47
R0234:Stk11ip UTSW 1 75529067 missense possibly damaging 0.47
R0617:Stk11ip UTSW 1 75532288 splice site probably null
R0712:Stk11ip UTSW 1 75527447 missense probably damaging 0.99
R1672:Stk11ip UTSW 1 75528985 nonsense probably null
R1694:Stk11ip UTSW 1 75527386 missense probably damaging 1.00
R1891:Stk11ip UTSW 1 75532416 missense probably benign 0.08
R2061:Stk11ip UTSW 1 75529584 missense possibly damaging 0.94
R2094:Stk11ip UTSW 1 75525521 splice site probably benign
R2851:Stk11ip UTSW 1 75529267 splice site probably benign
R2852:Stk11ip UTSW 1 75529267 splice site probably benign
R4765:Stk11ip UTSW 1 75527155 missense probably damaging 1.00
R4775:Stk11ip UTSW 1 75533853 missense possibly damaging 0.95
R4785:Stk11ip UTSW 1 75530281 missense possibly damaging 0.95
R5002:Stk11ip UTSW 1 75532543 intron probably benign
R5524:Stk11ip UTSW 1 75532327 missense probably damaging 1.00
R5538:Stk11ip UTSW 1 75528335 missense probably damaging 1.00
R5849:Stk11ip UTSW 1 75527355 splice site probably null
R5927:Stk11ip UTSW 1 75524691 missense possibly damaging 0.93
R6053:Stk11ip UTSW 1 75534255 critical splice donor site probably null
R6734:Stk11ip UTSW 1 75532369 missense probably benign 0.04
R6768:Stk11ip UTSW 1 75532635 missense probably benign
R7070:Stk11ip UTSW 1 75527615 missense probably benign 0.39
R7882:Stk11ip UTSW 1 75529464 missense probably benign 0.03
X0066:Stk11ip UTSW 1 75534426 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGATGGACTCTATGCAAGGGC -3'
(R):5'- AATGGGGTCAGTACTGCAAGC -3'

Sequencing Primer
(F):5'- CAAGGGCTTTGTGTCAGACCAG -3'
(R):5'- TGCAAGCAGCTCCTGAGG -3'
Posted On2018-05-21