Mutagenetix > Incidental Mutations

Incidental Mutation 'R5840:Thbs2'

450400

Institutional Source

Beutler Lab

Gene Symbol

Thbs2

Ensembl Gene

ENSMUSG00000023885

Gene Name

thrombospondin 2

Synonyms

Thbs-2, Thrombospondin-2, TSP2

MMRRC Submission

044060-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.154) question?

Stock #

R5840 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

14665500-14694235 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 14681430 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000128308 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170872]

Predicted Effect

probably null
Transcript: ENSMUST00000170872

SMART Domains

Protein: ENSMUSP00000128308
Gene: ENSMUSG00000023885

Domain	Start	End	E-Value	Type
low complexity region	2	10	N/A	INTRINSIC
TSPN	21	215	3.8e-60	SMART
VWC	320	374	3.55e-19	SMART
TSP1	384	431	3.36e-11	SMART
TSP1	440	492	1.35e-15	SMART
TSP1	497	549	8.6e-18	SMART
EGF	552	589	6.3e-3	SMART
EGF	593	647	1.56e1	SMART
EGF	651	692	2.19e-2	SMART
Pfam:TSP_3	729	764	2.5e-12	PFAM
Pfam:TSP_3	763	787	7.4e-7	PFAM
Pfam:TSP_3	788	823	9.4e-12	PFAM
Pfam:TSP_3	823	846	4.1e-7	PFAM
Pfam:TSP_3	847	884	1.7e-12	PFAM
Pfam:TSP_3	885	920	1.3e-11	PFAM
Pfam:TSP_3	921	956	3.1e-11	PFAM
Pfam:TSP_C	974	1171	1e-98	PFAM

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.8%
3x: 99.3%
10x: 96.5%
20x: 88.1%

Validation Efficiency

99% (75/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the thrombospondin family. It is a disulfide-linked homotrimeric glycoprotein that mediates cell-to-cell and cell-to-matrix interactions. This protein has been shown to function as a potent inhibitor of tumor growth and angiogenesis. Studies of the mouse counterpart suggest that this protein may modulate the cell surface properties of mesenchymal cells and be involved in cell adhesion and migration. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display premature death, abnormal tails, marked structural and functional abnormalities in a variety of connective tissues including skin, tendon, bone, and blood vessels, accelerated wound healing, and enhanced susceptibility to experimental skin tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca2	G	A	2: 25,433,359	R113Q	probably benign	Het
Aip	G	A	19: 4,116,010	P147L	possibly damaging	Het
Anapc1	A	C	2: 128,607,037		probably benign	Het
Arhgap42	C	T	9: 9,046,517	V240I	possibly damaging	Het
Axdnd1	T	C	1: 156,348,958	E684G	probably damaging	Het
BC005624	G	A	2: 30,981,857	R2W	probably benign	Het
Cd177	T	G	7: 24,758,070	Q182P	probably damaging	Het
Cdca5	G	A	19: 6,090,369	E187K	possibly damaging	Het
Chmp1a	T	C	8: 123,208,100	Q39R	probably benign	Het
Dab2ip	A	G	2: 35,727,499	I1079V	probably damaging	Het
Dip2c	A	T	13: 9,506,676	E85D	possibly damaging	Het
Elmo2	A	T	2: 165,295,552	S497R	possibly damaging	Het
Ephb6	C	T	6: 41,615,573	A339V	possibly damaging	Het
Foxred1	T	C	9: 35,210,139	K38E	probably damaging	Het
Frem2	T	A	3: 53,647,921	T1732S	probably damaging	Het
Fto	A	G	8: 91,666,440		probably benign	Het
Gm17430	T	A	18: 9,726,528	Q48L	probably damaging	Het
Gng2	A	G	14: 19,875,814	I70T	probably damaging	Het
Gtf2a2	A	G	9: 70,015,293		probably benign	Het
Invs	A	G	4: 48,396,284	D263G	probably damaging	Het
Itga2b	C	T	11: 102,461,331	V475M	probably damaging	Het
Kansl1l	A	G	1: 66,770,215		probably benign	Het
Klhl25	T	C	7: 75,866,692	F449L	possibly damaging	Het
Lamb1	T	A	12: 31,266,756	C83S	probably damaging	Het
Loxl4	G	T	19: 42,598,715	T648K	probably damaging	Het
Lrit2	T	C	14: 37,069,005	F214L	possibly damaging	Het
N4bp2	T	G	5: 65,808,094	L1162R	probably damaging	Het
Naa40	A	T	19: 7,230,008	I117N	probably benign	Het
Ncapd3	T	C	9: 27,094,758	S1492P	probably benign	Het
Nf2	T	A	11: 4,816,146	D128V	probably benign	Het
Nox4	T	C	7: 87,360,793	S401P	probably benign	Het
Nt5c1b	T	C	12: 10,377,171	V323A	probably damaging	Het
Olfr1474	G	A	19: 13,471,878	V303I	probably benign	Het
Olfr601	T	A	7: 103,358,369	H275L	probably damaging	Het
Olfr622	C	T	7: 103,639,256	V295I	probably benign	Het
Pcdhb14	T	C	18: 37,448,750	V303A	probably benign	Het
Pde8a	C	A	7: 81,213,965	H17Q	probably benign	Het
Pfkl	C	T	10: 77,988,724	V716I	probably benign	Het
Phc3	G	A	3: 30,936,583	S495L	possibly damaging	Het
Psg18	A	G	7: 18,346,602		probably benign	Het
Rcc2	T	G	4: 140,712,138	N175K	possibly damaging	Het
Rhot2	G	A	17: 25,840,058	T276I	probably benign	Het
Rnase9	A	T	14: 51,038,988	Y178N	probably benign	Het
Sema4b	T	C	7: 80,218,949	C297R	probably damaging	Het
Slc35d2	T	C	13: 64,118,413		probably null	Het
Sptlc3	A	T	2: 139,547,206	N169Y	probably damaging	Het
Srsf9	T	G	5: 115,331,465	M29R	probably benign	Het
Stip1	C	A	19: 7,022,068	D449Y	possibly damaging	Het
Syne2	T	A	12: 75,880,291		probably null	Het
Tgm5	A	G	2: 121,085,660		probably null	Het
Trak2	T	C	1: 58,919,273	E283G	probably damaging	Het
Trbv21	A	G	6: 41,202,858	Y36C	probably damaging	Het
Trpm7	A	T	2: 126,822,611	Y949*	probably null	Het
Ubqln5	T	C	7: 104,128,954	D221G	possibly damaging	Het
Ubxn4	T	A	1: 128,259,525	V85D	possibly damaging	Het
Vmn1r172	T	A	7: 23,660,175	W162R	probably benign	Het
Vrk2	A	G	11: 26,534,314		probably benign	Het
Zc3h8	A	C	2: 128,929,904	D276E	probably benign	Het
Zfp369	C	T	13: 65,297,278	T745I	possibly damaging	Het
Zfp608	T	C	18: 54,898,906	K654R	probably damaging	Het

Other mutations in Thbs2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00155:Thbs2	APN	17	14668835	missense	probably damaging	1.00
IGL00764:Thbs2	APN	17	14690252	missense	probably damaging	0.98
IGL01370:Thbs2	APN	17	14690065	missense	possibly damaging	0.82
IGL01604:Thbs2	APN	17	14678769	missense	probably benign	0.31
IGL01936:Thbs2	APN	17	14687814	missense	probably benign	0.00
IGL02061:Thbs2	APN	17	14679914	missense	probably benign	0.35
IGL02255:Thbs2	APN	17	14689785	missense	probably benign	0.00
IGL02342:Thbs2	APN	17	14676316	missense	probably damaging	1.00
IGL02402:Thbs2	APN	17	14671454	missense	probably benign	0.01
IGL02499:Thbs2	APN	17	14684066	splice site	probably benign
IGL02572:Thbs2	APN	17	14677013	missense	possibly damaging	0.72
IGL02701:Thbs2	APN	17	14683361	missense	probably benign	0.05
IGL02871:Thbs2	APN	17	14685786	missense	probably benign
IGL03058:Thbs2	APN	17	14689969	missense	possibly damaging	0.91
IGL03185:Thbs2	APN	17	14681410	nonsense	probably null
IGL03232:Thbs2	APN	17	14691413	start codon destroyed	probably null
IGL03289:Thbs2	APN	17	14690122	missense	probably benign	0.00
IGL03407:Thbs2	APN	17	14673273	missense	probably benign	0.00
H8562:Thbs2	UTSW	17	14671453	missense	probably benign	0.00
IGL02802:Thbs2	UTSW	17	14684127	missense	probably benign	0.01
PIT4354001:Thbs2	UTSW	17	14689968	missense	probably damaging	0.99
R0088:Thbs2	UTSW	17	14681701	missense	possibly damaging	0.96
R0167:Thbs2	UTSW	17	14667525	splice site	probably benign
R0415:Thbs2	UTSW	17	14679973	missense	probably benign
R0658:Thbs2	UTSW	17	14680325	missense	probably benign	0.00
R0735:Thbs2	UTSW	17	14679815	missense	probably benign	0.00
R1582:Thbs2	UTSW	17	14671288	missense	probably damaging	1.00
R1585:Thbs2	UTSW	17	14689768	missense	probably benign	0.00
R1608:Thbs2	UTSW	17	14685781	missense	probably benign
R1721:Thbs2	UTSW	17	14678810	missense	probably benign	0.00
R1724:Thbs2	UTSW	17	14685900	missense	possibly damaging	0.80
R1791:Thbs2	UTSW	17	14685813	missense	probably benign
R1816:Thbs2	UTSW	17	14670713	missense	probably benign	0.01
R1816:Thbs2	UTSW	17	14670714	missense	probably benign	0.00
R1911:Thbs2	UTSW	17	14689842	missense	probably benign	0.38
R2137:Thbs2	UTSW	17	14673306	missense	probably damaging	1.00
R2152:Thbs2	UTSW	17	14673209	missense	probably damaging	1.00
R2244:Thbs2	UTSW	17	14671413	missense	probably damaging	1.00
R2325:Thbs2	UTSW	17	14690289	splice site	probably null
R2509:Thbs2	UTSW	17	14685843	missense	probably benign	0.11
R3838:Thbs2	UTSW	17	14687851	missense	probably benign
R4173:Thbs2	UTSW	17	14681631	intron	probably null
R4427:Thbs2	UTSW	17	14680335	missense	probably benign
R4495:Thbs2	UTSW	17	14671413	missense	probably damaging	1.00
R4789:Thbs2	UTSW	17	14671488	missense	probably damaging	1.00
R4928:Thbs2	UTSW	17	14678900	missense	probably damaging	1.00
R5058:Thbs2	UTSW	17	14676329	missense	probably damaging	1.00
R5112:Thbs2	UTSW	17	14670590	splice site	probably null
R5619:Thbs2	UTSW	17	14681244	missense	probably damaging	1.00
R5649:Thbs2	UTSW	17	14689953	missense	probably damaging	1.00
R5664:Thbs2	UTSW	17	14689837	missense	probably damaging	1.00
R5801:Thbs2	UTSW	17	14687863	missense	probably damaging	1.00
R5816:Thbs2	UTSW	17	14684071	critical splice donor site	probably null
R6149:Thbs2	UTSW	17	14679680	critical splice donor site	probably null
R6166:Thbs2	UTSW	17	14680388	missense	probably damaging	1.00
R6412:Thbs2	UTSW	17	14677077	missense	probably damaging	1.00
R6473:Thbs2	UTSW	17	14685796	missense	probably benign	0.23
R6640:Thbs2	UTSW	17	14673368	missense	possibly damaging	0.94
R6695:Thbs2	UTSW	17	14674164	missense	possibly damaging	0.54
R6711:Thbs2	UTSW	17	14690265	missense	probably benign	0.00
R6947:Thbs2	UTSW	17	14689767	missense	possibly damaging	0.79
R6962:Thbs2	UTSW	17	14681820	missense	probably benign	0.00
R7183:Thbs2	UTSW	17	14690116	missense	possibly damaging	0.90
R7203:Thbs2	UTSW	17	14671458	missense	probably damaging	1.00
R7386:Thbs2	UTSW	17	14673150	missense	possibly damaging	0.95
R7621:Thbs2	UTSW	17	14674164	missense	probably benign
S24628:Thbs2	UTSW	17	14679973	missense	probably benign
X0025:Thbs2	UTSW	17	14681800	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TACTCACTTGGGCACGGATC -3'
(R):5'- GTTCCTCATGTGGGTATGCCAAC -3'

Sequencing Primer
(F):5'- ATCACGCTGACAGGGTTTG -3'
(R):5'- GCCAACAGCAGCTATTTGATG -3'

Posted On

2016-12-20