Incidental Mutation 'R6536:9930111J21Rik2'
ID520427
Institutional Source Beutler Lab
Gene Symbol 9930111J21Rik2
Ensembl Gene ENSMUSG00000069892
Gene NameRIKEN cDNA 9930111J21 gene 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.338) question?
Stock #R6536 (G1)
Quality Score203.009
Status Validated
Chromosome11
Chromosomal Location49015874-49051242 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 49019723 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 628 (H628N)
Ref Sequence ENSEMBL: ENSMUSP00000098853 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056759] [ENSMUST00000101295] [ENSMUST00000179282]
Predicted Effect probably benign
Transcript: ENSMUST00000056759
SMART Domains Protein: ENSMUSP00000058544
Gene: ENSMUSG00000040328

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 4 227 5.7e-7 PFAM
Pfam:7tm_1 10 259 1.5e-33 PFAM
Pfam:7tm_4 108 252 1.7e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101295
AA Change: H628N

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000098853
Gene: ENSMUSG00000069892
AA Change: H628N

DomainStartEndE-ValueType
Pfam:IIGP 36 398 2e-125 PFAM
Pfam:DLIC 52 107 3.2e-5 PFAM
Pfam:MMR_HSR1 72 235 2e-11 PFAM
low complexity region 430 444 N/A INTRINSIC
Pfam:IIGP 447 820 2.3e-151 PFAM
Pfam:MMR_HSR1 483 607 5.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179282
SMART Domains Protein: ENSMUSP00000136647
Gene: ENSMUSG00000040328

DomainStartEndE-ValueType
Pfam:7tm_4 1 276 3.6e-51 PFAM
Pfam:7TM_GPCR_Srsx 4 227 5.7e-7 PFAM
Pfam:7tm_1 10 259 3.8e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T A 5: 8,719,030 F751I probably benign Het
Adamts13 G A 2: 26,975,750 V106M probably damaging Het
Add1 C A 5: 34,601,436 N31K possibly damaging Het
Adgrf5 G T 17: 43,422,661 probably benign Het
Akap11 T G 14: 78,511,314 D1211A possibly damaging Het
Atp5c1 G A 2: 10,080,316 probably benign Het
Cd320 T C 17: 33,847,503 S72P probably benign Het
Clca4b C A 3: 144,916,729 W525L possibly damaging Het
Csmd3 G A 15: 47,838,467 T1740I probably damaging Het
Dnah7c T G 1: 46,658,290 S2122A probably benign Het
Enpp2 T C 15: 54,862,631 N583S probably damaging Het
Fuk A G 8: 110,883,879 V964A possibly damaging Het
Gpd2 A T 2: 57,345,355 I366F probably benign Het
Hsd17b2 G A 8: 117,702,182 V63M possibly damaging Het
Hsdl2 A T 4: 59,610,508 probably null Het
Idh3b AG AGCACCACAACTG 2: 130,279,673 probably null Het
Ifi44 A G 3: 151,732,489 V387A probably benign Het
Kcnc4 T C 3: 107,448,196 D312G possibly damaging Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Klra6 C T 6: 130,023,719 V41I probably benign Het
Lrp1 A G 10: 127,558,068 probably null Het
Mpdz T C 4: 81,383,417 E257G probably damaging Het
Olfr1306 T C 2: 111,912,774 D52G possibly damaging Het
Olfr1420 T C 19: 11,896,396 V125A probably benign Het
Papln A G 12: 83,781,887 Y789C probably damaging Het
Pcdh15 T C 10: 74,631,389 L1680P probably damaging Het
Pcdhac1 A G 18: 37,090,314 N60S probably benign Het
Polr3g T C 13: 81,678,216 N162S unknown Het
Pou3f3 A G 1: 42,698,214 I357V probably damaging Het
Sycp2 A G 2: 178,351,648 S1235P probably damaging Het
Tdgf1 A T 9: 110,944,189 probably null Het
Tns3 A T 11: 8,434,531 V1429E probably damaging Het
Trim67 T C 8: 124,794,342 S148P possibly damaging Het
Usp49 A T 17: 47,679,692 I348F probably damaging Het
Wac A T 18: 7,905,189 probably null Het
Zfp775 A G 6: 48,619,609 K139R probably damaging Het
Other mutations in 9930111J21Rik2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1986:9930111J21Rik2 UTSW 11 49019292 missense possibly damaging 0.83
R2023:9930111J21Rik2 UTSW 11 49020317 missense probably benign 0.01
R2202:9930111J21Rik2 UTSW 11 49019322 missense probably damaging 1.00
R2205:9930111J21Rik2 UTSW 11 49019322 missense probably damaging 1.00
R2337:9930111J21Rik2 UTSW 11 49020304 missense probably benign 0.01
R3709:9930111J21Rik2 UTSW 11 49019653 missense probably damaging 1.00
R3716:9930111J21Rik2 UTSW 11 49019536 missense probably damaging 0.96
R3738:9930111J21Rik2 UTSW 11 49019281 nonsense probably null
R3739:9930111J21Rik2 UTSW 11 49019281 nonsense probably null
R4034:9930111J21Rik2 UTSW 11 49019281 nonsense probably null
R5413:9930111J21Rik2 UTSW 11 49020377 missense possibly damaging 0.91
R5595:9930111J21Rik2 UTSW 11 49019711 missense possibly damaging 0.95
R5611:9930111J21Rik2 UTSW 11 49020001 missense possibly damaging 0.91
R5651:9930111J21Rik2 UTSW 11 49019873 missense probably damaging 0.99
R5715:9930111J21Rik2 UTSW 11 49019950 missense probably damaging 1.00
R6169:9930111J21Rik2 UTSW 11 49019261 splice site probably null
R6218:9930111J21Rik2 UTSW 11 49019307 missense probably benign 0.06
R7186:9930111J21Rik2 UTSW 11 49019273 missense possibly damaging 0.96
R7891:9930111J21Rik2 UTSW 11 49019716 missense probably benign 0.11
R8056:9930111J21Rik2 UTSW 11 49020082 missense probably benign 0.40
R8419:9930111J21Rik2 UTSW 11 49019485 missense probably damaging 1.00
R8726:9930111J21Rik2 UTSW 11 49019680 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATCCCTCTTCCGGGCAATG -3'
(R):5'- TCTGACAGAAATGAAGTTTGGTGAG -3'

Sequencing Primer
(F):5'- CAATGGCAGTCTCAGTAACACTGTG -3'
(R):5'- ATCTCGGCTACATGCTTCAAAG -3'
Posted On2018-06-06