Incidental Mutation 'R6614:Bysl'
ID523891
Institutional Source Beutler Lab
Gene Symbol Bysl
Ensembl Gene ENSMUSG00000023988
Gene Namebystin-like
SynonymsEnp1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6614 (G1)
Quality Score222.009
Status Validated
Chromosome17
Chromosomal Location47599331-47611492 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 47601842 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 341 (L341Q)
Ref Sequence ENSEMBL: ENSMUSP00000024783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024783] [ENSMUST00000037333] [ENSMUST00000171031] [ENSMUST00000182129] [ENSMUST00000182209] [ENSMUST00000182506] [ENSMUST00000182539] [ENSMUST00000182848] [ENSMUST00000182874] [ENSMUST00000183044] [ENSMUST00000183210] [ENSMUST00000183177] [ENSMUST00000183206] [ENSMUST00000183158] [ENSMUST00000183256]
Predicted Effect probably damaging
Transcript: ENSMUST00000024783
AA Change: L341Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024783
Gene: ENSMUSG00000023988
AA Change: L341Q

DomainStartEndE-ValueType
low complexity region 34 47 N/A INTRINSIC
low complexity region 52 69 N/A INTRINSIC
Pfam:Bystin 140 430 1.1e-144 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000037333
SMART Domains Protein: ENSMUSP00000040488
Gene: ENSMUSG00000034165

DomainStartEndE-ValueType
CYCLIN 62 146 1.12e-17 SMART
Cyclin_C 155 280 3.49e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171031
SMART Domains Protein: ENSMUSP00000126141
Gene: ENSMUSG00000034165

DomainStartEndE-ValueType
CYCLIN 62 146 1.12e-17 SMART
Cyclin_C 155 280 3.49e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182129
SMART Domains Protein: ENSMUSP00000138486
Gene: ENSMUSG00000034165

DomainStartEndE-ValueType
CYCLIN 62 146 1.12e-17 SMART
Pfam:Cyclin_C 155 214 2.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182209
SMART Domains Protein: ENSMUSP00000138091
Gene: ENSMUSG00000034165

DomainStartEndE-ValueType
CYCLIN 62 146 1.12e-17 SMART
Cyclin_C 155 280 3.49e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182281
Predicted Effect probably benign
Transcript: ENSMUST00000182506
SMART Domains Protein: ENSMUSP00000138180
Gene: ENSMUSG00000034165

DomainStartEndE-ValueType
CYCLIN 62 146 1.12e-17 SMART
Cyclin_C 155 251 2.02e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182539
SMART Domains Protein: ENSMUSP00000138458
Gene: ENSMUSG00000034165

DomainStartEndE-ValueType
Pfam:Cyclin_C 1 84 1.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182846
Predicted Effect probably benign
Transcript: ENSMUST00000182848
SMART Domains Protein: ENSMUSP00000138715
Gene: ENSMUSG00000034165

DomainStartEndE-ValueType
CYCLIN 62 146 1.12e-17 SMART
Pfam:Cyclin_C 155 243 8.1e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182874
SMART Domains Protein: ENSMUSP00000138711
Gene: ENSMUSG00000034165

DomainStartEndE-ValueType
PDB:3G33|D 1 69 3e-42 PDB
SCOP:d1g3nc1 22 67 9e-10 SMART
Blast:CYCLIN 26 66 9e-10 BLAST
PDB:2W9F|A 73 119 3e-9 PDB
Blast:CYCLIN 87 119 4e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000183044
SMART Domains Protein: ENSMUSP00000138220
Gene: ENSMUSG00000034165

DomainStartEndE-ValueType
CYCLIN 62 146 1.12e-17 SMART
Cyclin_C 155 280 3.49e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183210
Predicted Effect probably benign
Transcript: ENSMUST00000183177
SMART Domains Protein: ENSMUSP00000138640
Gene: ENSMUSG00000034165

DomainStartEndE-ValueType
CYCLIN 62 146 1.12e-17 SMART
Cyclin_C 155 280 3.49e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183206
Predicted Effect probably benign
Transcript: ENSMUST00000183158
SMART Domains Protein: ENSMUSP00000138169
Gene: ENSMUSG00000034165

DomainStartEndE-ValueType
CYCLIN 1 82 1.71e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183256
SMART Domains Protein: ENSMUSP00000138528
Gene: ENSMUSG00000034165

DomainStartEndE-ValueType
Pfam:Cyclin_C 1 70 9.4e-12 PFAM
Meta Mutation Damage Score 0.9207 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Bystin is expressed as a 2-kb major transcript and a 3.6-kb minor transcript in SNG-M cells and in human trophoblastic teratocarcinoma HT-H cells. Protein binding assays determined that bystin binds directly to trophinin and tastin, and that binding is enhanced when cytokeratins 8 and 18 are present. Immunocytochemistry of HT-H cells showed that bystin colocalizes with trophinin, tastin, and the cytokeratins, suggesting that these molecules form a complex in trophectoderm cells at the time of implantation. Using immunohistochemistry it was determined that trophinin and bystin are found in the placenta from the sixth week of pregnancy. Both proteins were localized in the cytoplasm of the syncytiotrophoblast in the chorionic villi and in endometrial decidual cells at the uteroplacental interface. After week 10, the levels of trophinin, tastin, and bystin decreased and then disappeared from placental villi. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality shortly after implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik T A 8: 124,861,247 probably null Het
4932415D10Rik T A 10: 82,291,648 N1843Y probably benign Het
Abca13 A T 11: 9,294,371 N2078I probably benign Het
Abcc2 A G 19: 43,819,361 I814V probably benign Het
Adamts4 A G 1: 171,256,624 R557G probably benign Het
C130026I21Rik A C 1: 85,202,060 probably null Het
Csmd1 C T 8: 17,216,787 G41D probably damaging Het
Dnah11 T C 12: 117,886,676 D4221G possibly damaging Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Dnajc21 A G 15: 10,470,263 probably null Het
Elavl1 C A 8: 4,289,818 A255S probably damaging Het
Filip1 C T 9: 79,815,839 G1166D probably damaging Het
Gm17727 A G 9: 35,777,125 W55R probably damaging Het
Gnptg T C 17: 25,235,261 Y184C probably damaging Het
Ifit3b A T 19: 34,611,519 S32C probably benign Het
Kcnh7 T G 2: 62,777,596 Y547S probably damaging Het
Lima1 G A 15: 99,783,580 A243V probably damaging Het
Mast3 T A 8: 70,781,966 I67F possibly damaging Het
Ncor1 A C 11: 62,330,819 M1283R probably benign Het
Ndufv1 G A 19: 4,008,749 T253I probably benign Het
Neurog1 G T 13: 56,251,824 Q37K probably benign Het
Nol4 T G 18: 22,920,856 K200Q probably damaging Het
Obscn T C 11: 59,012,801 H7599R probably benign Het
Olfr57 C A 10: 79,035,091 C98* probably null Het
Olfr728 T A 14: 50,140,364 I92F probably damaging Het
Olfr733 T A 14: 50,299,037 I91L probably benign Het
Olfr739 C T 14: 50,425,089 T190I probably benign Het
Olfr96 T C 17: 37,225,899 V258A probably benign Het
Oog4 A G 4: 143,437,875 V362A possibly damaging Het
Oosp1 T A 19: 11,690,950 D23V probably damaging Het
P2rx3 A G 2: 85,035,199 I34T probably damaging Het
Pla2g4a A T 1: 149,842,235 V621E probably benign Het
Prpf39 T G 12: 65,042,563 V25G probably benign Het
Psd T C 19: 46,313,412 K913E probably benign Het
Ptx4 A T 17: 25,122,702 R50S possibly damaging Het
Rex2 A T 4: 147,052,561 M16L probably benign Het
Serac1 A T 17: 6,045,662 V604E probably damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Stxbp6 T A 12: 44,861,275 T187S probably benign Het
Tg G A 15: 66,735,259 C215Y probably damaging Het
Top2b A T 14: 16,407,142 K671* probably null Het
Trmt1 G T 8: 84,689,333 V7L probably benign Het
Ttn C T 2: 76,784,830 R15102H probably benign Het
Uhrf1bp1 T A 17: 27,876,925 I70N probably benign Het
Unc79 A T 12: 102,991,430 I35F probably damaging Het
Other mutations in Bysl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Bysl APN 17 47601871 missense probably benign 0.25
IGL01343:Bysl APN 17 47601889 missense probably benign 0.02
IGL01982:Bysl APN 17 47611071 splice site probably null
IGL03048:Bysl APN 17 47602635 splice site probably null
IGL03227:Bysl APN 17 47611092 missense probably benign 0.01
R0115:Bysl UTSW 17 47610942 missense probably benign
R0243:Bysl UTSW 17 47606896 missense possibly damaging 0.93
R0685:Bysl UTSW 17 47602471 missense probably benign 0.25
R2511:Bysl UTSW 17 47604335 missense probably benign
R4202:Bysl UTSW 17 47604326 missense probably benign 0.31
R5636:Bysl UTSW 17 47602723 missense probably benign 0.25
R7311:Bysl UTSW 17 47601785 missense possibly damaging 0.75
R7463:Bysl UTSW 17 47602471 missense probably benign 0.25
X0025:Bysl UTSW 17 47611091 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGCTCACGCCTGATCTCAG -3'
(R):5'- TAATCAACAGGTGAGCAGCCTG -3'

Sequencing Primer
(F):5'- TGATCTCAGGGGACAGCTG -3'
(R):5'- AGGTGAGCAGCCTGTGGTG -3'
Posted On2018-06-22