Incidental Mutation 'R7463:Bysl'
ID578591
Institutional Source Beutler Lab
Gene Symbol Bysl
Ensembl Gene ENSMUSG00000023988
Gene Namebystin-like
SynonymsEnp1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7463 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location47599331-47611492 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 47602471 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 296 (S296T)
Ref Sequence ENSEMBL: ENSMUSP00000024783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024783] [ENSMUST00000037333] [ENSMUST00000171031] [ENSMUST00000182129] [ENSMUST00000182209] [ENSMUST00000182506] [ENSMUST00000182539] [ENSMUST00000182848] [ENSMUST00000182874] [ENSMUST00000183044] [ENSMUST00000183158] [ENSMUST00000183177] [ENSMUST00000183206] [ENSMUST00000183256]
Predicted Effect probably benign
Transcript: ENSMUST00000024783
AA Change: S296T

PolyPhen 2 Score 0.255 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000024783
Gene: ENSMUSG00000023988
AA Change: S296T

DomainStartEndE-ValueType
low complexity region 34 47 N/A INTRINSIC
low complexity region 52 69 N/A INTRINSIC
Pfam:Bystin 140 430 1.1e-144 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000037333
SMART Domains Protein: ENSMUSP00000040488
Gene: ENSMUSG00000034165

DomainStartEndE-ValueType
CYCLIN 62 146 1.12e-17 SMART
Cyclin_C 155 280 3.49e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171031
SMART Domains Protein: ENSMUSP00000126141
Gene: ENSMUSG00000034165

DomainStartEndE-ValueType
CYCLIN 62 146 1.12e-17 SMART
Cyclin_C 155 280 3.49e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182129
SMART Domains Protein: ENSMUSP00000138486
Gene: ENSMUSG00000034165

DomainStartEndE-ValueType
CYCLIN 62 146 1.12e-17 SMART
Pfam:Cyclin_C 155 214 2.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182209
SMART Domains Protein: ENSMUSP00000138091
Gene: ENSMUSG00000034165

DomainStartEndE-ValueType
CYCLIN 62 146 1.12e-17 SMART
Cyclin_C 155 280 3.49e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182281
Predicted Effect probably benign
Transcript: ENSMUST00000182506
SMART Domains Protein: ENSMUSP00000138180
Gene: ENSMUSG00000034165

DomainStartEndE-ValueType
CYCLIN 62 146 1.12e-17 SMART
Cyclin_C 155 251 2.02e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182539
SMART Domains Protein: ENSMUSP00000138458
Gene: ENSMUSG00000034165

DomainStartEndE-ValueType
Pfam:Cyclin_C 1 84 1.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182846
Predicted Effect probably benign
Transcript: ENSMUST00000182848
SMART Domains Protein: ENSMUSP00000138715
Gene: ENSMUSG00000034165

DomainStartEndE-ValueType
CYCLIN 62 146 1.12e-17 SMART
Pfam:Cyclin_C 155 243 8.1e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182874
SMART Domains Protein: ENSMUSP00000138711
Gene: ENSMUSG00000034165

DomainStartEndE-ValueType
PDB:3G33|D 1 69 3e-42 PDB
SCOP:d1g3nc1 22 67 9e-10 SMART
Blast:CYCLIN 26 66 9e-10 BLAST
PDB:2W9F|A 73 119 3e-9 PDB
Blast:CYCLIN 87 119 4e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000183044
SMART Domains Protein: ENSMUSP00000138220
Gene: ENSMUSG00000034165

DomainStartEndE-ValueType
CYCLIN 62 146 1.12e-17 SMART
Cyclin_C 155 280 3.49e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183158
SMART Domains Protein: ENSMUSP00000138169
Gene: ENSMUSG00000034165

DomainStartEndE-ValueType
CYCLIN 1 82 1.71e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183177
SMART Domains Protein: ENSMUSP00000138640
Gene: ENSMUSG00000034165

DomainStartEndE-ValueType
CYCLIN 62 146 1.12e-17 SMART
Cyclin_C 155 280 3.49e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183206
Predicted Effect probably benign
Transcript: ENSMUST00000183256
SMART Domains Protein: ENSMUSP00000138528
Gene: ENSMUSG00000034165

DomainStartEndE-ValueType
Pfam:Cyclin_C 1 70 9.4e-12 PFAM
Meta Mutation Damage Score 0.2366 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Bystin is expressed as a 2-kb major transcript and a 3.6-kb minor transcript in SNG-M cells and in human trophoblastic teratocarcinoma HT-H cells. Protein binding assays determined that bystin binds directly to trophinin and tastin, and that binding is enhanced when cytokeratins 8 and 18 are present. Immunocytochemistry of HT-H cells showed that bystin colocalizes with trophinin, tastin, and the cytokeratins, suggesting that these molecules form a complex in trophectoderm cells at the time of implantation. Using immunohistochemistry it was determined that trophinin and bystin are found in the placenta from the sixth week of pregnancy. Both proteins were localized in the cytoplasm of the syncytiotrophoblast in the chorionic villi and in endometrial decidual cells at the uteroplacental interface. After week 10, the levels of trophinin, tastin, and bystin decreased and then disappeared from placental villi. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality shortly after implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,323,772 V435E probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adcy2 T C 13: 68,730,280 D413G probably damaging Het
Adgrg6 T A 10: 14,434,396 D727V possibly damaging Het
Aebp2 C T 6: 140,637,726 Q309* probably null Het
Amy1 A T 3: 113,569,884 C43* probably null Het
Bpifc T C 10: 85,979,334 E256G probably benign Het
Carmil3 C T 14: 55,502,396 P980L probably damaging Het
Coch T A 12: 51,593,625 M1K probably null Het
Cpt2 A T 4: 107,908,157 F137I probably damaging Het
Crem T C 18: 3,295,094 I112V probably benign Het
Cul9 A G 17: 46,520,476 probably null Het
Cyp3a41a T A 5: 145,713,564 I90F probably damaging Het
Cyp4f16 C T 17: 32,550,787 A457V possibly damaging Het
Ddx6 A G 9: 44,628,729 E318G probably damaging Het
Dip2b A G 15: 100,154,157 E213G probably benign Het
Dlx5 T C 6: 6,878,316 H238R probably damaging Het
Dnaic2 A C 11: 114,754,406 I556L probably benign Het
Dnmt1 C T 9: 20,912,225 V1147M possibly damaging Het
Egf G T 3: 129,740,015 Q59K probably benign Het
Ermp1 A T 19: 29,646,262 Y109* probably null Het
Fer1l6 T A 15: 58,573,601 Y573* probably null Het
Fmnl1 T C 11: 103,193,128 L503P probably damaging Het
Gnptab T G 10: 88,431,389 I447M probably damaging Het
Hgf G A 5: 16,578,450 D253N probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Igf2r T C 17: 12,710,645 T958A probably benign Het
Kcnd2 T A 6: 21,216,498 L67Q probably damaging Het
Kif5a A G 10: 127,243,724 V248A probably damaging Het
Krt33b A G 11: 100,029,563 I88T probably damaging Het
Lhx2 G A 2: 38,351,846 E25K possibly damaging Het
Mex3d C T 10: 80,381,698 G562R Het
Myom2 A T 8: 15,117,679 Y1088F probably null Het
Ncapg T A 5: 45,694,092 probably null Het
Nudc A C 4: 133,534,403 V190G possibly damaging Het
Obscn G T 11: 59,122,860 R1054S probably benign Het
Olfr1045 T C 2: 86,197,838 M305V probably benign Het
Olfr1510 A G 14: 52,410,711 W54R probably benign Het
Olfr651 T C 7: 104,553,482 S188P possibly damaging Het
Olfr683 T A 7: 105,143,937 M119L probably benign Het
Olfr710 A T 7: 106,944,173 V276E probably damaging Het
Olfr979 A G 9: 40,000,564 V221A probably benign Het
Pcdh10 A T 3: 45,383,572 R891S possibly damaging Het
Pcdh15 C T 10: 74,631,770 S1873L possibly damaging Het
Pcdh7 A G 5: 57,720,998 K632E probably benign Het
Pcdhgb8 G A 18: 37,763,427 A517T probably damaging Het
Ptgr2 A T 12: 84,292,298 probably benign Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Racgap1 T A 15: 99,642,958 T4S probably benign Het
Rb1cc1 A G 1: 6,249,180 H941R probably benign Het
Reln T C 5: 22,103,435 H312R probably damaging Het
Rnf166 T A 8: 122,467,987 H208L probably damaging Het
Theg T C 10: 79,576,715 E314G probably damaging Het
Timeless T C 10: 128,250,426 S999P probably benign Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Tor1aip1 A T 1: 156,007,609 H349Q possibly damaging Het
Ttn T A 2: 76,920,460 E3415V probably benign Het
Vmn2r102 A T 17: 19,676,624 N78Y probably damaging Het
Wdr11 A T 7: 129,607,086 D427V probably damaging Het
Zer1 A T 2: 30,113,437 probably benign Het
Zfp516 T A 18: 82,957,108 M477K probably benign Het
Other mutations in Bysl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Bysl APN 17 47601871 missense probably benign 0.25
IGL01343:Bysl APN 17 47601889 missense probably benign 0.02
IGL01982:Bysl APN 17 47611071 unclassified probably null
IGL03048:Bysl APN 17 47602635 splice site probably null
IGL03227:Bysl APN 17 47611092 missense probably benign 0.01
R0115:Bysl UTSW 17 47610942 missense probably benign
R0243:Bysl UTSW 17 47606896 missense possibly damaging 0.93
R0685:Bysl UTSW 17 47602471 missense probably benign 0.25
R2511:Bysl UTSW 17 47604335 missense probably benign
R4202:Bysl UTSW 17 47604326 missense probably benign 0.31
R5636:Bysl UTSW 17 47602723 missense probably benign 0.25
R6614:Bysl UTSW 17 47601842 missense probably damaging 1.00
R7311:Bysl UTSW 17 47601785 missense possibly damaging 0.75
X0025:Bysl UTSW 17 47611091 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGGCTAGACTCGAGGTAATC -3'
(R):5'- CAAGAAGGCCCTGTTCAAGC -3'

Sequencing Primer
(F):5'- CGGCTAGACTCGAGGTAATCATAGC -3'
(R):5'- CCTGGAGCCTGGTTCAAAGGTAG -3'
Posted On2019-10-07