Incidental Mutation 'R0685:Bysl'
ID 61147
Institutional Source Beutler Lab
Gene Symbol Bysl
Ensembl Gene ENSMUSG00000023988
Gene Name bystin-like
Synonyms Enp1
MMRRC Submission 038870-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0685 (G1)
Quality Score 93
Status Validated
Chromosome 17
Chromosomal Location 47599331-47611492 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 47602471 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 296 (S296T)
Ref Sequence ENSEMBL: ENSMUSP00000024783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024783] [ENSMUST00000037333] [ENSMUST00000171031] [ENSMUST00000182129] [ENSMUST00000182209] [ENSMUST00000182506] [ENSMUST00000182539] [ENSMUST00000182848] [ENSMUST00000182874] [ENSMUST00000183044] [ENSMUST00000183177] [ENSMUST00000183158] [ENSMUST00000183206] [ENSMUST00000183256]
AlphaFold O54825
Predicted Effect probably benign
Transcript: ENSMUST00000024783
AA Change: S296T

PolyPhen 2 Score 0.255 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000024783
Gene: ENSMUSG00000023988
AA Change: S296T

DomainStartEndE-ValueType
low complexity region 34 47 N/A INTRINSIC
low complexity region 52 69 N/A INTRINSIC
Pfam:Bystin 140 430 1.1e-144 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000037333
SMART Domains Protein: ENSMUSP00000040488
Gene: ENSMUSG00000034165

DomainStartEndE-ValueType
CYCLIN 62 146 1.12e-17 SMART
Cyclin_C 155 280 3.49e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171031
SMART Domains Protein: ENSMUSP00000126141
Gene: ENSMUSG00000034165

DomainStartEndE-ValueType
CYCLIN 62 146 1.12e-17 SMART
Cyclin_C 155 280 3.49e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182129
SMART Domains Protein: ENSMUSP00000138486
Gene: ENSMUSG00000034165

DomainStartEndE-ValueType
CYCLIN 62 146 1.12e-17 SMART
Pfam:Cyclin_C 155 214 2.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182209
SMART Domains Protein: ENSMUSP00000138091
Gene: ENSMUSG00000034165

DomainStartEndE-ValueType
CYCLIN 62 146 1.12e-17 SMART
Cyclin_C 155 280 3.49e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182281
Predicted Effect probably benign
Transcript: ENSMUST00000182506
SMART Domains Protein: ENSMUSP00000138180
Gene: ENSMUSG00000034165

DomainStartEndE-ValueType
CYCLIN 62 146 1.12e-17 SMART
Cyclin_C 155 251 2.02e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182539
SMART Domains Protein: ENSMUSP00000138458
Gene: ENSMUSG00000034165

DomainStartEndE-ValueType
Pfam:Cyclin_C 1 84 1.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182846
Predicted Effect probably benign
Transcript: ENSMUST00000182848
SMART Domains Protein: ENSMUSP00000138715
Gene: ENSMUSG00000034165

DomainStartEndE-ValueType
CYCLIN 62 146 1.12e-17 SMART
Pfam:Cyclin_C 155 243 8.1e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182874
SMART Domains Protein: ENSMUSP00000138711
Gene: ENSMUSG00000034165

DomainStartEndE-ValueType
PDB:3G33|D 1 69 3e-42 PDB
SCOP:d1g3nc1 22 67 9e-10 SMART
Blast:CYCLIN 26 66 9e-10 BLAST
PDB:2W9F|A 73 119 3e-9 PDB
Blast:CYCLIN 87 119 4e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000183044
SMART Domains Protein: ENSMUSP00000138220
Gene: ENSMUSG00000034165

DomainStartEndE-ValueType
CYCLIN 62 146 1.12e-17 SMART
Cyclin_C 155 280 3.49e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183177
SMART Domains Protein: ENSMUSP00000138640
Gene: ENSMUSG00000034165

DomainStartEndE-ValueType
CYCLIN 62 146 1.12e-17 SMART
Cyclin_C 155 280 3.49e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183158
SMART Domains Protein: ENSMUSP00000138169
Gene: ENSMUSG00000034165

DomainStartEndE-ValueType
CYCLIN 1 82 1.71e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183206
Predicted Effect probably benign
Transcript: ENSMUST00000183256
SMART Domains Protein: ENSMUSP00000138528
Gene: ENSMUSG00000034165

DomainStartEndE-ValueType
Pfam:Cyclin_C 1 70 9.4e-12 PFAM
Meta Mutation Damage Score 0.2366 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 98% (89/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Bystin is expressed as a 2-kb major transcript and a 3.6-kb minor transcript in SNG-M cells and in human trophoblastic teratocarcinoma HT-H cells. Protein binding assays determined that bystin binds directly to trophinin and tastin, and that binding is enhanced when cytokeratins 8 and 18 are present. Immunocytochemistry of HT-H cells showed that bystin colocalizes with trophinin, tastin, and the cytokeratins, suggesting that these molecules form a complex in trophectoderm cells at the time of implantation. Using immunohistochemistry it was determined that trophinin and bystin are found in the placenta from the sixth week of pregnancy. Both proteins were localized in the cytoplasm of the syncytiotrophoblast in the chorionic villi and in endometrial decidual cells at the uteroplacental interface. After week 10, the levels of trophinin, tastin, and bystin decreased and then disappeared from placental villi. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality shortly after implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik A G 10: 21,593,438 D17G probably damaging Het
Abi3bp A G 16: 56,532,953 T82A possibly damaging Het
Adgre4 A C 17: 55,792,035 E180D probably benign Het
Ankrd28 G A 14: 31,743,450 probably benign Het
Aoc3 A G 11: 101,336,447 D382G possibly damaging Het
Apob C A 12: 8,010,742 R3075S probably benign Het
Aqr A G 2: 114,140,977 F459S probably damaging Het
Bcr T C 10: 75,131,643 W570R probably damaging Het
Bloc1s5 C T 13: 38,603,919 R163K probably benign Het
Bod1 A T 11: 31,669,267 N101K possibly damaging Het
Chl1 G A 6: 103,708,542 probably null Het
Clstn1 G A 4: 149,646,855 A885T probably benign Het
Cyp3a25 G T 5: 145,998,546 P87T probably damaging Het
Dync1h1 T C 12: 110,657,192 V3633A probably damaging Het
Elp4 C A 2: 105,792,277 C241F possibly damaging Het
Fat4 T A 3: 39,001,178 F4182Y probably benign Het
Gabbr2 G A 4: 46,787,521 H381Y possibly damaging Het
Gm10577 G T 4: 101,020,318 probably benign Het
Gm884 T C 11: 103,616,888 probably benign Het
Gm9955 G T 18: 24,709,257 probably benign Het
Gstm5 T A 3: 107,897,319 I73N probably damaging Het
Gypa T A 8: 80,496,702 probably benign Het
Hectd2 T A 19: 36,569,431 V64D probably damaging Het
Igkv10-95 T A 6: 68,680,559 Y20N probably benign Het
Il15 T C 8: 82,337,559 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kiz C A 2: 146,856,058 probably benign Het
Lcmt2 C A 2: 121,139,240 S234I probably benign Het
Lilra5 A G 7: 4,241,957 probably benign Het
Lin37 T C 7: 30,555,874 E187G probably damaging Het
Mcmdc2 T A 1: 9,911,814 probably null Het
Mctp1 T C 13: 76,825,799 probably null Het
Mdp1 C A 14: 55,659,269 G112* probably null Het
Mmp15 T C 8: 95,372,134 Y530H possibly damaging Het
Mtss1l T C 8: 110,727,397 probably null Het
Muc5ac T C 7: 141,807,709 S1586P probably benign Het
Nap1l5 A T 6: 58,906,772 C66S possibly damaging Het
Ninl G T 2: 150,939,855 Q1237K possibly damaging Het
Olfr1160 T C 2: 88,006,418 E111G probably damaging Het
Olfr495 A T 7: 108,395,263 T48S possibly damaging Het
Orc6 T G 8: 85,301,154 S37R possibly damaging Het
Papss1 A C 3: 131,583,093 N119H possibly damaging Het
Phf13 A T 4: 151,991,612 F278I probably damaging Het
Pole2 C A 12: 69,211,413 A239S probably damaging Het
Ppt2 T C 17: 34,626,572 D75G probably damaging Het
Psd2 A G 18: 36,002,991 D443G possibly damaging Het
Psen1 C A 12: 83,714,820 S132* probably null Het
Psme4 A G 11: 30,878,415 T1812A probably damaging Het
Rasgrf1 T C 9: 89,915,482 probably benign Het
Reep3 A G 10: 67,021,739 probably benign Het
Rexo4 A T 2: 26,958,574 probably benign Het
Rnf6 A C 5: 146,211,658 S183R probably damaging Het
Scai A T 2: 39,103,737 M297K probably damaging Het
Scn9a A T 2: 66,483,499 S1947R probably benign Het
Sema6c T C 3: 95,172,710 C772R possibly damaging Het
Skint7 T C 4: 111,980,345 S107P possibly damaging Het
Slc24a3 A G 2: 145,606,795 N420D probably benign Het
Smc1b T C 15: 85,070,820 D1077G possibly damaging Het
Smg7 G A 1: 152,866,648 P82L probably damaging Het
Sp3 A C 2: 72,970,998 F268V probably damaging Het
Srms T C 2: 181,212,633 D47G probably benign Het
Ss18 A C 18: 14,651,181 M150R probably damaging Het
Taf5 G A 19: 47,074,854 R281Q probably benign Het
Tars T C 15: 11,385,173 K644R probably benign Het
Tctex1d1 T C 4: 103,002,538 Y96H probably damaging Het
Tinag C A 9: 76,952,003 W441L probably damaging Het
Tmtc1 T C 6: 148,411,240 S244G probably benign Het
Tpr T C 1: 150,433,725 V1670A possibly damaging Het
Trpv3 A G 11: 73,296,814 probably benign Het
Uhrf1 G T 17: 56,310,742 V155L probably damaging Het
Ush2a G A 1: 188,400,278 C899Y probably damaging Het
Vmn2r115 G A 17: 23,359,275 R574H probably benign Het
Vmn2r63 T C 7: 42,928,010 D368G probably benign Het
Vps13a A G 19: 16,780,741 V10A probably damaging Het
Wbp11 A G 6: 136,814,638 probably benign Het
Zcwpw1 A G 5: 137,799,592 D145G probably benign Het
Zfp607a G A 7: 27,878,476 V324I probably damaging Het
Zfp618 A G 4: 63,133,774 I931V probably benign Het
Zfp821 T C 8: 109,724,542 V389A possibly damaging Het
Zfp976 T A 7: 42,613,717 H232L probably damaging Het
Other mutations in Bysl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Bysl APN 17 47601871 missense probably benign 0.25
IGL01343:Bysl APN 17 47601889 missense probably benign 0.02
IGL01982:Bysl APN 17 47611071 splice site probably null
IGL03048:Bysl APN 17 47602635 splice site probably null
IGL03227:Bysl APN 17 47611092 missense probably benign 0.01
R0115:Bysl UTSW 17 47610942 missense probably benign
R0243:Bysl UTSW 17 47606896 missense possibly damaging 0.93
R2511:Bysl UTSW 17 47604335 missense probably benign
R4202:Bysl UTSW 17 47604326 missense probably benign 0.31
R5636:Bysl UTSW 17 47602723 missense probably benign 0.25
R6614:Bysl UTSW 17 47601842 missense probably damaging 1.00
R7311:Bysl UTSW 17 47601785 missense possibly damaging 0.75
R7463:Bysl UTSW 17 47602471 missense probably benign 0.25
R8861:Bysl UTSW 17 47606959 missense probably benign 0.01
R9114:Bysl UTSW 17 47604317 missense
R9666:Bysl UTSW 17 47603940 missense probably benign 0.14
X0025:Bysl UTSW 17 47611091 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCCATTTACACACGCAGTCATTC -3'
(R):5'- CCTGGTTCAAAGGTAGAGCAGAAGC -3'

Sequencing Primer
(F):5'- GTTGGAGTAATCATACACCCACTG -3'
(R):5'- GTAGAGCAGAAGCAGGGG -3'
Posted On 2013-07-30