Mutagenetix > Incidental Mutation

Incidental Mutation 'R6614:Mast3'

523838

Institutional Source

Beutler Lab

Gene Symbol

Mast3

Ensembl Gene

ENSMUSG00000031833

Gene Name

microtubule associated serine/threonine kinase 3

Synonyms

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_199308.2. MGI:2683541

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6614 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

70778117-70805054 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 70781966 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 67 (I67F)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166004] [ENSMUST00000211948]

AlphaFold

Q3U214

Predicted Effect

probably benign
Transcript: ENSMUST00000166004
AA Change: I832F

PolyPhen 2 Score 0.170 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: I832F

Domain	Start	End	E-Value	Type
low complexity region	43	59	N/A	INTRINSIC
Pfam:DUF1908	64	337	4.4e-128	PFAM
S_TKc	373	646	2.77e-99	SMART
S_TK_X	647	710	2.39e-1	SMART
low complexity region	820	833	N/A	INTRINSIC
low complexity region	910	942	N/A	INTRINSIC
PDZ	958	1038	3.8e-15	SMART
low complexity region	1053	1074	N/A	INTRINSIC
low complexity region	1089	1121	N/A	INTRINSIC
low complexity region	1124	1150	N/A	INTRINSIC
low complexity region	1180	1204	N/A	INTRINSIC
low complexity region	1231	1248	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191396

Predicted Effect

probably benign
Transcript: ENSMUST00000211948
AA Change: I816F

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000212140
AA Change: I67F

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212172

Meta Mutation Damage Score

0.0794

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.3%

Validation Efficiency

98% (46/47)

Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810004N23Rik	T	A	8: 124,861,247		probably null	Het
4932415D10Rik	T	A	10: 82,291,648	N1843Y	probably benign	Het
Abca13	A	T	11: 9,294,371	N2078I	probably benign	Het
Abcc2	A	G	19: 43,819,361	I814V	probably benign	Het
Adamts4	A	G	1: 171,256,624	R557G	probably benign	Het
Bysl	A	T	17: 47,601,842	L341Q	probably damaging	Het
C130026I21Rik	A	C	1: 85,202,060		probably null	Het
Csmd1	C	T	8: 17,216,787	G41D	probably damaging	Het
Dnah11	T	C	12: 117,886,676	D4221G	possibly damaging	Het
Dnah7c	C	A	1: 46,649,340	T1890K	probably benign	Het
Dnah7c	A	G	1: 46,649,351	S1894G	probably benign	Het
Dnajc21	A	G	15: 10,470,263		probably null	Het
Elavl1	C	A	8: 4,289,818	A255S	probably damaging	Het
Filip1	C	T	9: 79,815,839	G1166D	probably damaging	Het
Gm17727	A	G	9: 35,777,125	W55R	probably damaging	Het
Gnptg	T	C	17: 25,235,261	Y184C	probably damaging	Het
Ifit3b	A	T	19: 34,611,519	S32C	probably benign	Het
Kcnh7	T	G	2: 62,777,596	Y547S	probably damaging	Het
Lima1	G	A	15: 99,783,580	A243V	probably damaging	Het
Ncor1	A	C	11: 62,330,819	M1283R	probably benign	Het
Ndufv1	G	A	19: 4,008,749	T253I	probably benign	Het
Neurog1	G	T	13: 56,251,824	Q37K	probably benign	Het
Nol4	T	G	18: 22,920,856	K200Q	probably damaging	Het
Obscn	T	C	11: 59,012,801	H7599R	probably benign	Het
Olfr57	C	A	10: 79,035,091	C98*	probably null	Het
Olfr728	T	A	14: 50,140,364	I92F	probably damaging	Het
Olfr733	T	A	14: 50,299,037	I91L	probably benign	Het
Olfr739	C	T	14: 50,425,089	T190I	probably benign	Het
Olfr96	T	C	17: 37,225,899	V258A	probably benign	Het
Oog4	A	G	4: 143,437,875	V362A	possibly damaging	Het
Oosp1	T	A	19: 11,690,950	D23V	probably damaging	Het
P2rx3	A	G	2: 85,035,199	I34T	probably damaging	Het
Pla2g4a	A	T	1: 149,842,235	V621E	probably benign	Het
Prpf39	T	G	12: 65,042,563	V25G	probably benign	Het
Psd	T	C	19: 46,313,412	K913E	probably benign	Het
Ptx4	A	T	17: 25,122,702	R50S	possibly damaging	Het
Rex2	A	T	4: 147,052,561	M16L	probably benign	Het
Serac1	A	T	17: 6,045,662	V604E	probably damaging	Het
Srsf11	C	T	3: 158,023,344		probably benign	Het
Stxbp6	T	A	12: 44,861,275	T187S	probably benign	Het
Tg	G	A	15: 66,735,259	C215Y	probably damaging	Het
Top2b	A	T	14: 16,407,142	K671*	probably null	Het
Trmt1	G	T	8: 84,689,333	V7L	probably benign	Het
Ttn	C	T	2: 76,784,830	R15102H	probably benign	Het
Uhrf1bp1	T	A	17: 27,876,925	I70N	probably benign	Het
Unc79	A	T	12: 102,991,430	I35F	probably damaging	Het

Other mutations in Mast3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00952:Mast3	APN	8	70780683	splice site	probably benign
IGL01411:Mast3	APN	8	70779583	missense	possibly damaging	0.50
IGL01475:Mast3	APN	8	70779530	missense	probably damaging	1.00
IGL01886:Mast3	APN	8	70782139	missense	possibly damaging	0.94
IGL02104:Mast3	APN	8	70787906	missense	possibly damaging	0.78
IGL02236:Mast3	APN	8	70789244	missense	probably benign	0.36
IGL02437:Mast3	APN	8	70780558	missense	possibly damaging	0.79
IGL02704:Mast3	APN	8	70786875	missense	probably damaging	1.00
IGL03155:Mast3	APN	8	70789217	missense	probably damaging	1.00
IGL03366:Mast3	APN	8	70781563	nonsense	probably null
gravy	UTSW	8	70786635	missense	probably damaging	1.00
stuffing	UTSW	8	70784797	frame shift	probably null
turkey	UTSW	8	70785482	missense	probably damaging	1.00
BB010:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
BB020:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R0037:Mast3	UTSW	8	70783699	critical splice donor site	probably null
R0280:Mast3	UTSW	8	70787920	missense	possibly damaging	0.65
R0280:Mast3	UTSW	8	70783795	missense	probably damaging	1.00
R0731:Mast3	UTSW	8	70781321	missense	probably damaging	1.00
R1101:Mast3	UTSW	8	70786663	missense	probably damaging	1.00
R1177:Mast3	UTSW	8	70780324	missense	probably damaging	1.00
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1333:Mast3	UTSW	8	70781294	missense	probably damaging	1.00
R1543:Mast3	UTSW	8	70792311	missense	possibly damaging	0.93
R1544:Mast3	UTSW	8	70786172	missense	probably damaging	1.00
R1738:Mast3	UTSW	8	70784556	missense	probably benign	0.38
R1842:Mast3	UTSW	8	70780393	missense	possibly damaging	0.91
R1936:Mast3	UTSW	8	70784800	missense	probably damaging	1.00
R2015:Mast3	UTSW	8	70787363	missense	probably benign	0.00
R2219:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R2220:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R3711:Mast3	UTSW	8	70779607	missense	probably benign	0.13
R3919:Mast3	UTSW	8	70779422	missense	probably benign	0.02
R4027:Mast3	UTSW	8	70787908	missense	probably damaging	1.00
R4060:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4061:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4062:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4063:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4588:Mast3	UTSW	8	70780607	nonsense	probably null
R4672:Mast3	UTSW	8	70784797	frame shift	probably null
R4770:Mast3	UTSW	8	70786220	missense	probably damaging	1.00
R4822:Mast3	UTSW	8	70780366	missense	probably damaging	1.00
R4830:Mast3	UTSW	8	70788915	missense	possibly damaging	0.87
R5196:Mast3	UTSW	8	70788245	missense	probably damaging	1.00
R5333:Mast3	UTSW	8	70783501	missense	probably benign	0.03
R5428:Mast3	UTSW	8	70784733	missense	possibly damaging	0.95
R5656:Mast3	UTSW	8	70786221	missense	probably damaging	1.00
R5920:Mast3	UTSW	8	70787933	missense	probably benign	0.00
R6177:Mast3	UTSW	8	70790018	missense	probably damaging	1.00
R6186:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
R6407:Mast3	UTSW	8	70782128	missense	probably benign	0.02
R6804:Mast3	UTSW	8	70786732	missense	probably benign	0.29
R6873:Mast3	UTSW	8	70786592	nonsense	probably null
R6930:Mast3	UTSW	8	70799471	nonsense	probably null
R6948:Mast3	UTSW	8	70785482	missense	probably damaging	1.00
R7084:Mast3	UTSW	8	70779473	missense	probably benign	0.14
R7253:Mast3	UTSW	8	70789682	critical splice donor site	probably null
R7316:Mast3	UTSW	8	70779788	missense	probably damaging	1.00
R7357:Mast3	UTSW	8	70784859	missense	probably damaging	1.00
R7405:Mast3	UTSW	8	70786171	missense	probably damaging	1.00
R7429:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7430:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7521:Mast3	UTSW	8	70788768	missense	probably benign	0.16
R7576:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R7933:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R7998:Mast3	UTSW	8	70783570	missense	probably benign
R8021:Mast3	UTSW	8	70788252	missense	probably benign	0.02
R8204:Mast3	UTSW	8	70788281	missense	probably benign	0.00
R8327:Mast3	UTSW	8	70779418	missense	probably damaging	1.00
R8357:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8415:Mast3	UTSW	8	70781222	missense	probably damaging	1.00
R8457:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8530:Mast3	UTSW	8	70788233	missense	possibly damaging	0.92
R8891:Mast3	UTSW	8	70781157	missense	probably damaging	1.00
R8930:Mast3	UTSW	8	70781733	splice site	probably benign
R9002:Mast3	UTSW	8	70781260	missense	probably damaging	1.00
R9085:Mast3	UTSW	8	70796717	missense	unknown
R9087:Mast3	UTSW	8	70789686	missense	possibly damaging	0.93
R9148:Mast3	UTSW	8	70780447	missense	probably damaging	0.98
R9364:Mast3	UTSW	8	70786182	missense	probably damaging	1.00
R9779:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
Z1177:Mast3	UTSW	8	70789038	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- GTGAGCTTGACACCTATCCATCTC -3'
(R):5'- AACAGGCTAAGGTCCTGGAC -3'

Sequencing Primer
(F):5'- CCCATGAAGGTAGAATGCAGGTTC -3'
(R):5'- TAAGGTCCTGGACACCTGC -3'

Posted On

2018-06-22