Incidental Mutation 'R6672:Lrpap1'
ID527165
Institutional Source Beutler Lab
Gene Symbol Lrpap1
Ensembl Gene ENSMUSG00000029103
Gene Namelow density lipoprotein receptor-related protein associated protein 1
SynonymsRAP
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6672 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location35091501-35105766 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 35099233 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 135 (M135K)
Ref Sequence ENSEMBL: ENSMUSP00000030986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030986]
Predicted Effect probably benign
Transcript: ENSMUST00000030986
AA Change: M135K

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000030986
Gene: ENSMUSG00000029103
AA Change: M135K

DomainStartEndE-ValueType
Pfam:Alpha-2-MRAP_N 20 137 7.7e-45 PFAM
Pfam:Alpha-2-MRAP_C 148 360 3.4e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132754
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147028
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152028
Predicted Effect probably benign
Transcript: ENSMUST00000153664
SMART Domains Protein: ENSMUSP00000120233
Gene: ENSMUSG00000029103

DomainStartEndE-ValueType
Pfam:Alpha-2-MRAP_C 2 153 4.7e-48 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that interacts with the low density lipoprotein (LDL) receptor-related protein and facilitates its proper folding and localization by preventing the binding of ligands. Mutations in this gene have been identified in individuals with myopia 23. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display an essentially normal phenotype. However, subtle abnormalities are seen in behavior, brain function and thyroid function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 A G 8: 40,681,533 E680G probably benign Het
Adam7 T A 14: 68,504,702 probably null Het
Arid2 C T 15: 96,362,345 T351I probably benign Het
Asz1 T A 6: 18,075,818 E252V possibly damaging Het
BC024978 C T 7: 27,204,064 probably benign Het
Chrm5 C T 2: 112,479,796 C325Y probably benign Het
Cyp2c65 A G 19: 39,087,674 R357G probably damaging Het
Dhx36 A G 3: 62,495,536 V265A probably damaging Het
Dhx36 T A 3: 62,500,879 E179D probably benign Het
Dip2c G A 13: 9,567,830 probably null Het
Dock10 A T 1: 80,512,531 M1958K probably benign Het
Dpf1 T C 7: 29,316,268 C357R probably damaging Het
Dync1h1 C T 12: 110,658,134 R3703C probably damaging Het
Eef1g A G 19: 8,967,047 probably null Het
Gnl2 T C 4: 125,048,393 V397A probably damaging Het
Gramd3 A G 18: 56,432,336 E21G possibly damaging Het
Grik3 C A 4: 125,623,516 Q51K probably benign Het
Hectd2 G T 19: 36,587,380 Q20H probably damaging Het
Krtap5-1 A G 7: 142,296,496 C192R unknown Het
Lrrc9 G A 12: 72,473,936 R664H possibly damaging Het
Mef2c T G 13: 83,652,856 V225G probably damaging Het
Nlrp9b T C 7: 20,019,338 L56P probably damaging Het
Nup133 T C 8: 123,916,281 probably null Het
Odf3 A G 7: 140,848,427 S25G probably benign Het
Olfr533 G A 7: 140,466,735 C178Y probably damaging Het
Olfr993 T A 2: 85,414,604 I92L possibly damaging Het
Ppp1r3d T C 2: 178,413,759 E150G possibly damaging Het
Smpd1 A G 7: 105,555,273 M120V probably benign Het
Zbtb46 A G 2: 181,411,836 L361P probably benign Het
Zfp605 A G 5: 110,127,997 H327R probably damaging Het
Other mutations in Lrpap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02219:Lrpap1 APN 5 35096067 splice site probably benign
IGL03102:Lrpap1 APN 5 35093350 missense probably damaging 0.98
R0029:Lrpap1 UTSW 5 35097677 missense possibly damaging 0.86
R0089:Lrpap1 UTSW 5 35094888 missense possibly damaging 0.93
R1944:Lrpap1 UTSW 5 35097630 missense probably benign 0.00
R1955:Lrpap1 UTSW 5 35102412 missense probably damaging 1.00
R3877:Lrpap1 UTSW 5 35098203 missense probably benign 0.04
R4004:Lrpap1 UTSW 5 35105544 nonsense probably null
R4077:Lrpap1 UTSW 5 35096037 missense possibly damaging 0.74
R4078:Lrpap1 UTSW 5 35096037 missense possibly damaging 0.74
R4079:Lrpap1 UTSW 5 35096037 missense possibly damaging 0.74
R4782:Lrpap1 UTSW 5 35099278 missense probably damaging 0.99
R4828:Lrpap1 UTSW 5 35102421 missense possibly damaging 0.95
R6925:Lrpap1 UTSW 5 35102536 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCGCACAGATCATGTCTC -3'
(R):5'- AACCTAAGCTGGTGCGTGTC -3'

Sequencing Primer
(F):5'- ACAGATCATGTCTCGCGGTG -3'
(R):5'- TCTCGTGTAGCCGCTCAGTG -3'
Posted On2018-07-23