Incidental Mutation 'R1558:Ttc6'
ID170441
Institutional Source Beutler Lab
Gene Symbol Ttc6
Ensembl Gene ENSMUSG00000046782
Gene Nametetratricopeptide repeat domain 6
SynonymsEG639426, LOC217602, Gm9813
MMRRC Submission 039597-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R1558 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location57564113-57737928 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 57686346 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 1092 (V1092I)
Ref Sequence ENSEMBL: ENSMUSP00000134273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172939]
Predicted Effect probably benign
Transcript: ENSMUST00000172939
AA Change: V1092I

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000134273
Gene: ENSMUSG00000046782
AA Change: V1092I

DomainStartEndE-ValueType
coiled coil region 18 42 N/A INTRINSIC
low complexity region 146 162 N/A INTRINSIC
low complexity region 188 212 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
low complexity region 486 495 N/A INTRINSIC
low complexity region 670 685 N/A INTRINSIC
low complexity region 733 740 N/A INTRINSIC
TPR 889 922 2e-4 SMART
TPR 957 989 2.36e1 SMART
TPR 990 1022 2.63e1 SMART
TPR 1023 1056 9.39e-1 SMART
TPR 1057 1090 3.78e-5 SMART
Blast:TPR 1126 1157 1e-11 BLAST
SEL1 1160 1192 3.39e1 SMART
TPR 1160 1194 4.44e1 SMART
TPR 1195 1228 7.87e0 SMART
Blast:TPR 1229 1262 1e-11 BLAST
TPR 1297 1330 1.24e0 SMART
SEL1 1341 1372 9.26e-1 SMART
TPR 1341 1374 3.45e-8 SMART
TPR 1375 1407 8.76e-1 SMART
TPR 1408 1441 1.45e-1 SMART
TPR 1442 1475 1.36e1 SMART
TPR 1476 1509 7.34e-3 SMART
TPR 1513 1546 1.01e0 SMART
TPR 1547 1580 2.55e-2 SMART
TPR 1581 1617 2.43e1 SMART
Blast:TPR 1618 1651 4e-12 BLAST
TPR 1652 1685 7.87e0 SMART
TPR 1686 1718 2.35e-1 SMART
SEL1 1719 1750 1.21e2 SMART
TPR 1719 1752 1.65e-5 SMART
TPR 1753 1786 1.66e-1 SMART
TPR 1787 1820 1.45e-1 SMART
TPR 1821 1854 3.27e0 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T A 17: 33,065,705 I708F probably benign Het
4933406M09Rik G A 1: 134,390,774 G428D probably damaging Het
Abca1 T A 4: 53,092,887 Q299L probably null Het
Adamts9 T G 6: 92,908,711 K399N possibly damaging Het
Alox12b T C 11: 69,165,885 F369S probably damaging Het
Alpk2 A G 18: 65,350,230 Y236H probably benign Het
Ankrd36 T C 11: 5,635,329 L380P probably damaging Het
Atp2a1 C T 7: 126,452,672 A468T possibly damaging Het
Caprin1 A T 2: 103,775,987 F303I possibly damaging Het
Casp7 A T 19: 56,433,252 R41* probably null Het
Ccdc66 T A 14: 27,486,506 H753L probably benign Het
Ccnc T C 4: 21,742,671 M166T probably benign Het
Cdkl3 T A 11: 52,032,510 M538K possibly damaging Het
Cercam G A 2: 29,876,239 A345T probably benign Het
Chmp3 T A 6: 71,560,970 C60* probably null Het
Ddx1 C T 12: 13,239,541 G125S probably damaging Het
Defb7 A G 8: 19,497,551 D24G probably benign Het
Dgcr8 A T 16: 18,259,588 Y653N probably damaging Het
Dsc2 T C 18: 20,050,151 D70G probably damaging Het
Erich3 T G 3: 154,714,068 N266K probably damaging Het
Fastk A T 5: 24,444,047 probably null Het
Fat4 A G 3: 38,888,986 N676S probably damaging Het
Fermt1 A T 2: 132,934,819 probably null Het
Fmn1 A G 2: 113,693,118 T1149A possibly damaging Het
Foxo3 A G 10: 42,197,072 V483A probably damaging Het
Fpgs T C 2: 32,685,840 T364A possibly damaging Het
Gm12185 A G 11: 48,915,435 S310P probably damaging Het
Gm15056 A T 8: 20,901,933 probably benign Het
Hcn1 T C 13: 117,975,576 V692A unknown Het
Izumo3 A C 4: 92,146,903 C26G probably damaging Het
Kcnf1 T C 12: 17,175,473 Y249C probably damaging Het
Kcnj6 T C 16: 94,762,499 E380G possibly damaging Het
Kdm3b A G 18: 34,809,096 T747A probably damaging Het
Lrba G A 3: 86,351,315 G1370R probably damaging Het
Mei1 G A 15: 82,107,133 R504Q probably damaging Het
Mipol1 T C 12: 57,332,341 I195T probably damaging Het
Mum1 G T 10: 80,232,944 R307S probably benign Het
Ncor2 G A 5: 125,033,546 T1350I probably damaging Het
Npy A G 6: 49,823,725 E43G probably damaging Het
Olfr1152 T A 2: 87,868,115 N41K probably damaging Het
Olfr1507 T A 14: 52,490,146 I273F probably benign Het
Olfr924 T A 9: 38,848,904 N263K probably benign Het
Pcdhb3 T C 18: 37,301,581 L200P probably damaging Het
Pcnt G A 10: 76,422,922 H570Y possibly damaging Het
Pkd1l2 A C 8: 117,082,252 D66E possibly damaging Het
Plekhg4 A G 8: 105,381,835 D1170G possibly damaging Het
Poln T A 5: 34,032,799 H672L probably benign Het
Pqlc2 A T 4: 139,300,080 probably benign Het
Ptprq T C 10: 107,644,043 Y1122C probably damaging Het
Ptrhd1 A G 12: 4,236,505 Y132C probably damaging Het
Riok1 G T 13: 38,050,855 R300L probably damaging Het
Sbf2 G T 7: 110,428,346 T481K probably damaging Het
Sidt2 A T 9: 45,951,800 M11K probably damaging Het
Syne1 G A 10: 5,349,280 R992* probably null Het
Tmem2 T A 19: 21,797,982 Y196* probably null Het
Tmem8b C A 4: 43,681,134 R384S possibly damaging Het
Trim28 T C 7: 13,027,834 Y243H probably damaging Het
Trpm6 T C 19: 18,786,828 M266T probably benign Het
Tsg101 A T 7: 46,889,689 S368T probably damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Vps13b C T 15: 35,534,319 T927I probably damaging Het
Zfr C T 15: 12,140,644 T259I unknown Het
Other mutations in Ttc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03278:Ttc6 APN 12 57622026 missense probably damaging 0.99
IGL02802:Ttc6 UTSW 12 57575868 missense probably benign 0.14
PIT4802001:Ttc6 UTSW 12 57725676 missense possibly damaging 0.89
R0698:Ttc6 UTSW 12 57673216 missense probably benign 0.04
R0988:Ttc6 UTSW 12 57688649 splice site probably benign
R1290:Ttc6 UTSW 12 57660413 missense probably benign 0.00
R1338:Ttc6 UTSW 12 57616369 missense probably benign 0.10
R1468:Ttc6 UTSW 12 57674677 missense possibly damaging 0.54
R1468:Ttc6 UTSW 12 57674677 missense possibly damaging 0.54
R1481:Ttc6 UTSW 12 57737130 missense probably damaging 1.00
R1488:Ttc6 UTSW 12 57649515 missense possibly damaging 0.66
R1570:Ttc6 UTSW 12 57674763 missense probably damaging 0.98
R1619:Ttc6 UTSW 12 57737668 missense possibly damaging 0.73
R1819:Ttc6 UTSW 12 57694500 critical splice donor site probably null
R1826:Ttc6 UTSW 12 57660247 missense probably benign 0.10
R1863:Ttc6 UTSW 12 57714095 missense probably benign 0.04
R1872:Ttc6 UTSW 12 57704552 critical splice donor site probably null
R1887:Ttc6 UTSW 12 57673258 missense probably benign 0.04
R1937:Ttc6 UTSW 12 57616323 missense probably benign 0.02
R2014:Ttc6 UTSW 12 57576217 missense possibly damaging 0.92
R2056:Ttc6 UTSW 12 57737693 missense probably benign 0.08
R2058:Ttc6 UTSW 12 57737693 missense probably benign 0.08
R2059:Ttc6 UTSW 12 57737693 missense probably benign 0.08
R2152:Ttc6 UTSW 12 57705552 missense probably damaging 0.98
R2179:Ttc6 UTSW 12 57673118 missense possibly damaging 0.62
R2275:Ttc6 UTSW 12 57702298 missense probably benign 0.01
R2432:Ttc6 UTSW 12 57622035 missense possibly damaging 0.79
R2474:Ttc6 UTSW 12 57575927 missense probably benign 0.37
R2853:Ttc6 UTSW 12 57576181 missense probably damaging 0.96
R3848:Ttc6 UTSW 12 57677146 missense probably damaging 0.97
R3853:Ttc6 UTSW 12 57728549 missense possibly damaging 0.88
R3950:Ttc6 UTSW 12 57649506 missense probably damaging 0.97
R3953:Ttc6 UTSW 12 57697452 missense probably benign 0.03
R3954:Ttc6 UTSW 12 57697452 missense probably benign 0.03
R3955:Ttc6 UTSW 12 57697452 missense probably benign 0.03
R3957:Ttc6 UTSW 12 57697452 missense probably benign 0.03
R4135:Ttc6 UTSW 12 57632795 intron probably benign
R4387:Ttc6 UTSW 12 57643050 missense probably benign 0.00
R4577:Ttc6 UTSW 12 57576655 missense probably benign 0.22
R4747:Ttc6 UTSW 12 57674692 missense possibly damaging 0.86
R4779:Ttc6 UTSW 12 57729451 missense probably damaging 1.00
R4803:Ttc6 UTSW 12 57728505 missense probably damaging 1.00
R4871:Ttc6 UTSW 12 57702356 missense probably damaging 0.96
R4898:Ttc6 UTSW 12 57660240 missense probably benign 0.00
R4930:Ttc6 UTSW 12 57673823 critical splice donor site probably null
R4946:Ttc6 UTSW 12 57643140 missense probably benign 0.01
R5257:Ttc6 UTSW 12 57702275 missense possibly damaging 0.92
R5303:Ttc6 UTSW 12 57575820 missense possibly damaging 0.90
R5385:Ttc6 UTSW 12 57643035 splice site probably null
R5402:Ttc6 UTSW 12 57737031 nonsense probably null
R5428:Ttc6 UTSW 12 57689834 missense probably null 0.98
R5436:Ttc6 UTSW 12 57674594 splice site probably null
R5646:Ttc6 UTSW 12 57576019 missense probably damaging 0.99
R5697:Ttc6 UTSW 12 57677214 missense probably benign 0.22
R5792:Ttc6 UTSW 12 57673204 missense possibly damaging 0.71
R5808:Ttc6 UTSW 12 57617611 missense possibly damaging 0.84
R5842:Ttc6 UTSW 12 57737016 missense probably damaging 1.00
R5935:Ttc6 UTSW 12 57673804 missense probably damaging 0.98
R6144:Ttc6 UTSW 12 57673100 missense possibly damaging 0.83
R6155:Ttc6 UTSW 12 57737616 missense possibly damaging 0.84
R6283:Ttc6 UTSW 12 57702262 missense possibly damaging 0.95
R6371:Ttc6 UTSW 12 57728463 missense possibly damaging 0.89
R6715:Ttc6 UTSW 12 57674770 critical splice donor site probably null
R6738:Ttc6 UTSW 12 57688640 missense probably damaging 0.99
R6795:Ttc6 UTSW 12 57704413 missense probably damaging 0.96
R6959:Ttc6 UTSW 12 57658142 splice site probably null
R7053:Ttc6 UTSW 12 57660532 missense probably benign 0.01
R7125:Ttc6 UTSW 12 57576339 missense probably benign 0.00
R7259:Ttc6 UTSW 12 57576184 missense probably benign 0.00
R7304:Ttc6 UTSW 12 57576051 missense probably damaging 0.96
R7369:Ttc6 UTSW 12 57672931 critical splice acceptor site probably null
R7409:Ttc6 UTSW 12 57696986 missense probably damaging 0.99
R7429:Ttc6 UTSW 12 57658102 missense probably benign 0.00
R7430:Ttc6 UTSW 12 57658102 missense probably benign 0.00
R7492:Ttc6 UTSW 12 57673136 missense probably benign 0.02
R7535:Ttc6 UTSW 12 57576519 missense probably benign 0.00
X0021:Ttc6 UTSW 12 57576118 missense probably damaging 0.96
X0058:Ttc6 UTSW 12 57706851 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCAGCACAACTAAGCTCTATTGGC -3'
(R):5'- TTCACACATCCGTGCGAGCAAC -3'

Sequencing Primer
(F):5'- CTAAGCTCTATTGGCAAGCAAAG -3'
(R):5'- CGTGCGAGCAACATACATAAAAAG -3'
Posted On2014-04-13