Incidental Mutation 'R6772:Tcaf1'
ID532207
Institutional Source Beutler Lab
Gene Symbol Tcaf1
Ensembl Gene ENSMUSG00000036667
Gene NameTRPM8 channel-associated factor 1
SynonymsA230020K05Rik, 2810407D09Rik, Fam115a, 3321401G04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R6772 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location42668002-42710088 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 42675276 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 757 (H757Q)
Ref Sequence ENSEMBL: ENSMUSP00000114036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045054] [ENSMUST00000045140] [ENSMUST00000121083]
Predicted Effect probably damaging
Transcript: ENSMUST00000045054
AA Change: H757Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046137
Gene: ENSMUSG00000036667
AA Change: H757Q

DomainStartEndE-ValueType
internal_repeat_1 14 197 6.95e-30 PROSPERO
low complexity region 207 221 N/A INTRINSIC
internal_repeat_1 222 406 6.95e-30 PROSPERO
low complexity region 463 474 N/A INTRINSIC
M60-like 542 841 1.94e-128 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000045140
AA Change: H757Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036379
Gene: ENSMUSG00000036667
AA Change: H757Q

DomainStartEndE-ValueType
internal_repeat_1 14 197 6.95e-30 PROSPERO
low complexity region 207 221 N/A INTRINSIC
internal_repeat_1 222 406 6.95e-30 PROSPERO
low complexity region 463 474 N/A INTRINSIC
M60-like 542 841 1.94e-128 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121083
AA Change: H757Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114036
Gene: ENSMUSG00000036667
AA Change: H757Q

DomainStartEndE-ValueType
internal_repeat_1 14 197 6.95e-30 PROSPERO
low complexity region 207 221 N/A INTRINSIC
internal_repeat_1 222 406 6.95e-30 PROSPERO
low complexity region 463 474 N/A INTRINSIC
M60-like 542 841 1.94e-128 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,527,053 D1144V probably damaging Het
Ankrd13a A G 5: 114,801,743 H477R probably benign Het
Anxa3 A T 5: 96,811,113 I27F probably damaging Het
Aplf T C 6: 87,663,799 E76G possibly damaging Het
Bbs1 A G 19: 4,906,590 probably benign Het
Camk2a T C 18: 60,969,020 S332P probably benign Het
Casz1 T A 4: 148,943,206 F1013L probably damaging Het
Cd109 A T 9: 78,680,810 I707F possibly damaging Het
Cd4 G A 6: 124,872,458 T202I probably benign Het
Celsr1 A G 15: 86,030,782 S997P probably benign Het
Cfap77 T C 2: 29,054,939 T24A probably damaging Het
Dscaml1 G A 9: 45,710,311 R1019H probably damaging Het
Epb41l4b C A 4: 57,063,140 V517F probably benign Het
Exosc10 G A 4: 148,581,134 D818N probably damaging Het
Furin C T 7: 80,393,492 G324S probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ifi206 T C 1: 173,481,207 M408V unknown Het
Kdm4a T C 4: 118,142,555 probably null Het
Neo1 T A 9: 58,902,976 Q1064L probably damaging Het
Nphp4 G A 4: 152,544,406 V750I probably benign Het
Pcdhac1 T C 18: 37,090,236 V34A probably benign Het
Pdk4 T C 6: 5,487,141 I302V probably benign Het
Prl6a1 A G 13: 27,319,048 D209G probably damaging Het
Pspn T C 17: 56,999,515 Q138R probably benign Het
Ptgs2 A G 1: 150,102,078 Y134C probably damaging Het
Rlbp1 G A 7: 79,384,050 probably benign Het
Rpia T C 6: 70,785,548 I108V probably benign Het
Ttc8 A C 12: 98,943,589 S143R probably damaging Het
Uba6 A G 5: 86,147,073 probably null Het
Ubr4 A T 4: 139,467,230 K4280* probably null Het
Vmn2r15 C A 5: 109,286,372 S822I probably damaging Het
Vps53 A T 11: 76,179,498 M1K probably null Het
Zfp362 A G 4: 128,790,260 M18T possibly damaging Het
Zfp429 A G 13: 67,390,198 C376R probably damaging Het
Zfyve9 T C 4: 108,639,269 N1395S probably damaging Het
Zmynd8 T A 2: 165,807,601 Q857H probably benign Het
Other mutations in Tcaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Tcaf1 APN 6 42686622 missense probably benign
IGL02415:Tcaf1 APN 6 42686650 missense probably benign 0.00
IGL02504:Tcaf1 APN 6 42679279 missense probably benign 0.05
IGL02960:Tcaf1 APN 6 42686459 missense probably benign
IGL03022:Tcaf1 APN 6 42678126 nonsense probably null
PIT4696001:Tcaf1 UTSW 6 42678539 missense probably benign 0.00
R0103:Tcaf1 UTSW 6 42686390 missense probably benign 0.23
R0103:Tcaf1 UTSW 6 42686390 missense probably benign 0.23
R0586:Tcaf1 UTSW 6 42673539 missense probably damaging 1.00
R0717:Tcaf1 UTSW 6 42678665 missense probably benign 0.01
R0724:Tcaf1 UTSW 6 42675367 missense probably damaging 1.00
R1166:Tcaf1 UTSW 6 42678678 missense probably benign
R1472:Tcaf1 UTSW 6 42686448 missense possibly damaging 0.83
R1538:Tcaf1 UTSW 6 42678989 missense probably damaging 1.00
R1721:Tcaf1 UTSW 6 42675338 missense possibly damaging 0.90
R1776:Tcaf1 UTSW 6 42678455 missense possibly damaging 0.90
R2136:Tcaf1 UTSW 6 42673520 missense probably benign 0.01
R3433:Tcaf1 UTSW 6 42686574 missense probably damaging 0.98
R3951:Tcaf1 UTSW 6 42679059 missense probably benign 0.14
R4472:Tcaf1 UTSW 6 42679314 missense probably benign
R4740:Tcaf1 UTSW 6 42686875 missense probably benign
R4915:Tcaf1 UTSW 6 42675196 missense probably damaging 1.00
R5249:Tcaf1 UTSW 6 42676859 missense probably benign 0.00
R5340:Tcaf1 UTSW 6 42678989 missense probably damaging 1.00
R5458:Tcaf1 UTSW 6 42686542 missense probably benign
R6196:Tcaf1 UTSW 6 42676807 missense probably damaging 1.00
R7066:Tcaf1 UTSW 6 42679177 missense probably damaging 1.00
R7145:Tcaf1 UTSW 6 42686753 missense probably damaging 1.00
R7204:Tcaf1 UTSW 6 42675039 splice site probably null
R7529:Tcaf1 UTSW 6 42675355 missense probably damaging 1.00
R7554:Tcaf1 UTSW 6 42677454 missense probably benign 0.13
R7813:Tcaf1 UTSW 6 42673429 nonsense probably null
RF013:Tcaf1 UTSW 6 42679173 missense probably benign 0.04
Z1177:Tcaf1 UTSW 6 42673477 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- AGTAGATTCGGACTCTCTTCTCC -3'
(R):5'- CCAGATGTGGTGATGAGGTG -3'

Sequencing Primer
(F):5'- TCCCGAACTGGAGGCCATAG -3'
(R):5'- ATGATCTGCAAGTTCCCAAGTC -3'
Posted On2018-08-29