Incidental Mutation 'R6744:Kifap3'
ID532764
Institutional Source Beutler Lab
Gene Symbol Kifap3
Ensembl Gene ENSMUSG00000026585
Gene Namekinesin-associated protein 3
SynonymsSmg GDS, KAP3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6744 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location163779583-163917109 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 163848670 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 398 (N398S)
Ref Sequence ENSEMBL: ENSMUSP00000076830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027877] [ENSMUST00000077642]
Predicted Effect probably benign
Transcript: ENSMUST00000027877
AA Change: N398S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000027877
Gene: ENSMUSG00000026585
AA Change: N398S

DomainStartEndE-ValueType
KAP 13 720 N/A SMART
ARM 333 373 1.21e-3 SMART
ARM 374 412 9.68e0 SMART
ARM 578 620 1.28e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077642
AA Change: N398S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000076830
Gene: ENSMUSG00000026585
AA Change: N398S

DomainStartEndE-ValueType
KAP 13 720 N/A SMART
ARM 333 373 1.21e-3 SMART
ARM 374 412 9.68e0 SMART
ARM 578 620 1.28e-2 SMART
Meta Mutation Damage Score 0.0698 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: The protein encoded by this gene is the non-motor subunit of kinesin-2 complex, and forms a heterotrimer with two members of the kinesin superfamily of proteins that together form a microtubule plus-end directed translocator that plays an important role in intracellular transport, mitosis, and cell-cell adhesion. This protein contains multiple armadillo repeats involved in protein binding, and may serve as an adaptor to regulate binding of cargo with the motor proteins. Conditional disruption of this gene in mouse neural precursor cells caused a tumor-like phenotype and defective organization of the neuroepithelium thought to be the result of altered N-cadherin subcellular localization. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2015]
PHENOTYPE: About 70% of homozygotes for a knock-out mutation die of heart failure shortly after birth due to massive cardiomyocyte apoptosis triggered by cardiovascular overload. Neonatal thymocytes and developing neuronal cells undergo apoptosis while cultured thymocytes are susceptible to apoptotic inducers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahi1 T A 10: 20,965,567 L251H probably damaging Het
Alk A T 17: 72,603,082 S210T probably benign Het
Arap2 A G 5: 62,748,938 F246S probably damaging Het
Atad5 T A 11: 80,134,032 N1749K probably benign Het
C130060K24Rik T A 6: 65,441,340 M164K possibly damaging Het
C87436 T A 6: 86,446,064 S207T probably damaging Het
C8b C T 4: 104,774,346 R53W probably damaging Het
Catsperg2 A G 7: 29,709,819 V619A probably benign Het
Cdc73 G A 1: 143,702,149 probably benign Het
Cdh4 C A 2: 179,847,387 H297Q possibly damaging Het
Col3a1 G T 1: 45,338,622 probably benign Het
Crybg2 A G 4: 134,088,896 N1328S probably damaging Het
Ctnnb1 T A 9: 120,952,959 V346E probably damaging Het
Ctns C T 11: 73,185,285 G308E probably damaging Het
Cxxc4 AGGCGGCGGCGGCGGCGGCGGCGGC AGGCGGCGGCGGCGGCGGCGGCGGCGGC 3: 134,240,130 probably benign Het
Dnah6 A G 6: 73,037,549 I3685T probably damaging Het
Dock6 T C 9: 21,831,474 H775R probably damaging Het
Fbxl3 A T 14: 103,083,294 V239D probably damaging Het
Gh T A 11: 106,301,404 K55* probably null Het
Gm49333 A T 16: 20,630,366 K165N probably damaging Het
Havcr2 T G 11: 46,455,060 probably null Het
Kcnq2 T A 2: 181,085,306 H576L possibly damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Mblac1 A G 5: 138,194,420 E8G possibly damaging Het
Mtor C T 4: 148,458,655 T290I probably benign Het
Nceh1 T C 3: 27,241,789 Y400H probably damaging Het
Nek9 A G 12: 85,329,929 V226A probably benign Het
Olfr119 T A 17: 37,701,445 Y258* probably null Het
Olfr518 T C 7: 108,880,830 T259A probably damaging Het
Olfr710 A G 7: 106,944,534 S156P probably damaging Het
Otud4 C A 8: 79,673,778 Y1039* probably null Het
Pax4 T C 6: 28,442,397 H331R probably benign Het
Piezo2 A T 18: 63,032,889 Y2090* probably null Het
Ppp1r12a T A 10: 108,230,534 H195Q probably damaging Het
Ppp6r2 A G 15: 89,256,661 probably null Het
Prodh A G 16: 18,079,200 V23A probably benign Het
Psg20 G A 7: 18,674,580 T405I probably damaging Het
Ptprf T C 4: 118,236,365 D360G probably benign Het
Rad18 A T 6: 112,675,784 M284K probably damaging Het
Rgs17 T C 10: 5,842,567 K60E possibly damaging Het
Sec31a G T 5: 100,392,499 Q39K possibly damaging Het
Slc22a22 G T 15: 57,254,272 T291K possibly damaging Het
Sult2a6 C T 7: 14,222,545 E264K probably damaging Het
Syne2 C T 12: 76,074,447 R5896C probably damaging Het
Tctn1 A T 5: 122,264,146 V75D probably damaging Het
Tmem214 A G 5: 30,874,028 K409E probably damaging Het
Vcan T C 13: 89,705,182 Y553C probably damaging Het
Vmn1r49 C T 6: 90,072,202 V273I probably benign Het
Other mutations in Kifap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Kifap3 APN 1 163797270 missense probably damaging 1.00
IGL01655:Kifap3 APN 1 163796049 splice site probably benign
IGL02385:Kifap3 APN 1 163865444 nonsense probably null
IGL02517:Kifap3 APN 1 163825871 splice site probably benign
IGL02756:Kifap3 APN 1 163862028 missense probably damaging 0.98
IGL03034:Kifap3 APN 1 163888277 missense probably benign 0.05
IGL03230:Kifap3 APN 1 163825724 missense probably benign 0.02
IGL03270:Kifap3 APN 1 163848733 missense probably benign 0.18
IGL03340:Kifap3 APN 1 163829149 missense possibly damaging 0.94
R0207:Kifap3 UTSW 1 163883386 missense probably benign 0.00
R0333:Kifap3 UTSW 1 163797264 missense probably damaging 1.00
R0426:Kifap3 UTSW 1 163865552 splice site probably benign
R1467:Kifap3 UTSW 1 163829120 splice site probably benign
R1482:Kifap3 UTSW 1 163825859 missense possibly damaging 0.91
R1547:Kifap3 UTSW 1 163794086 missense probably benign 0.01
R1704:Kifap3 UTSW 1 163829196 missense possibly damaging 0.50
R1724:Kifap3 UTSW 1 163783097 nonsense probably null
R1982:Kifap3 UTSW 1 163862022 nonsense probably null
R2233:Kifap3 UTSW 1 163856065 missense probably benign
R2273:Kifap3 UTSW 1 163868758 missense possibly damaging 0.94
R2274:Kifap3 UTSW 1 163868758 missense possibly damaging 0.94
R2275:Kifap3 UTSW 1 163868758 missense possibly damaging 0.94
R3420:Kifap3 UTSW 1 163794026 missense probably damaging 1.00
R3421:Kifap3 UTSW 1 163794026 missense probably damaging 1.00
R3422:Kifap3 UTSW 1 163794026 missense probably damaging 1.00
R4194:Kifap3 UTSW 1 163915825 missense probably benign 0.10
R4260:Kifap3 UTSW 1 163862028 missense probably damaging 0.98
R4464:Kifap3 UTSW 1 163817895 missense probably benign 0.00
R4635:Kifap3 UTSW 1 163814435 missense probably damaging 1.00
R5090:Kifap3 UTSW 1 163856076 missense possibly damaging 0.89
R5426:Kifap3 UTSW 1 163779871 start codon destroyed probably null 0.30
R5868:Kifap3 UTSW 1 163865472 missense probably damaging 1.00
R6107:Kifap3 UTSW 1 163868769 missense possibly damaging 0.50
R6437:Kifap3 UTSW 1 163857526 missense probably damaging 0.99
R7051:Kifap3 UTSW 1 163794080 missense probably damaging 1.00
R7143:Kifap3 UTSW 1 163825859 missense possibly damaging 0.91
R7143:Kifap3 UTSW 1 163856040 missense possibly damaging 0.66
R7216:Kifap3 UTSW 1 163795989 missense probably damaging 0.98
R7467:Kifap3 UTSW 1 163815833 missense probably benign
R7564:Kifap3 UTSW 1 163915768 missense probably damaging 1.00
R8108:Kifap3 UTSW 1 163797362 missense probably damaging 0.99
U24488:Kifap3 UTSW 1 163783035 missense possibly damaging 0.64
Z1177:Kifap3 UTSW 1 163862062 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATCGGTCTTGAAACTTCATAG -3'
(R):5'- TACTGCATTCTTCACCGTGTGG -3'

Sequencing Primer
(F):5'- CTTCATAGTTAACATAAGAGCGACTC -3'
(R):5'- CACAGGGCTTAGCATGTACTGTC -3'
Posted On2018-08-29